Morpholino

MO2-kdrl

ID
ZDB-MRPHLNO-080516-9
Name
MO2-kdrl
Previous Names
  • MO-kdra (1)
  • MO2-kdr
Target
Sequence
5' - CCGAATGATACTCCGTATGTCACTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-kdrl
No data available
Phenotype
Phenotype resulting from MO2-kdrl
Phenotype of all Fish created by or utilizing MO2-kdrl
Citations