Morpholino
MO2-cdh5
- ID
- ZDB-MRPHLNO-080506-1
- Name
- MO2-cdh5
- Previous Names
-
- MO4-cdh5
- Target
- Sequence
-
5' - TACAAGACCGTCTACCTTTCCAATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cdh5
No data available
Phenotype
Phenotype resulting from MO2-cdh5
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO2-cdh5
1 - 5 of 7 Show all
Citations
- Xu, B., Zhang, Y., Du, X.F., Li, J., Zi, H.X., Bu, J.W., Yan, Y., Han, H., Du, J.L. (2017) Neurons secrete miR-132-containing exosomes to regulate brain vascular integrity. Cell Research. 27(7):882-897
- Meng, P., Liu, Y., Chen, X., Zhang, W., Zhang, Y. (2016) Zebrafish Cdh5 negatively regulates mobilization of aorta-gonad-mesonephros-derived hematopoietic stem cells. Journal of genetics and genomics = Yi chuan xue bao. 43(10):613-616
- Anderson, H., Patch, T.C., Reddy, P.N., Hagedorn, E.J., Kim, P.G., Soltis, K.A., Chen, M.J., Tamplin, O.J., Frye, M., MacLean, G.A., Hübner, K., Bauer, D.E., Kanki, J.P., Vogin, G., Huston, N.C., Nguyen, M., Fujiwara, Y., Paw, B.H., Vestweber, D., Zon, L.I., Orkin, S.H., Daley, G.Q., Shah, D.I. (2015) Hematopoietic stem cells develop in the absence of endothelial cadherin 5 expression. Blood. 126(26):2811-20
- Abraham, S., Yeo, M., Montero-Balaguer, M., Paterson, H., Dejana, E., Marshall, C.J., and Mavria, G. (2009) VE-Cadherin-Mediated Cell-Cell Interaction Suppresses Sprouting via Signaling to MLC2 Phosphorylation. Current biology : CB. 19(8):668-674
- Montero-Balaguer, M., Swirsding, K., Orsenigo, F., Cotelli, F., Mione, M., and Dejana, E. (2009) Stable vascular connections and remodeling require full expression of VE-cadherin in zebrafish embryos. PLoS One. 4(6):e5772
1 - 5 of 5
Show