Morpholino
MO2-tnfrsf1a
- ID
- ZDB-MRPHLNO-080326-2
- Name
- MO2-tnfrsf1a
- Previous Names
-
- TR1v2 (1)
- Target
- Sequence
-
5' - CTGCATTGTGACTTACTTATCGCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tnfrsf1a
No data available
Phenotype
Phenotype resulting from MO2-tnfrsf1a
No data available
Phenotype of all Fish created by or utilizing MO2-tnfrsf1a
from 1 - 5 of 9 Show all
Citations
- Troll, J.V., Hamilton, M.K., Abel, M.L., Ganz, J., Bates, J.M., Stephens, W.Z., Melancon, E., van der Vaart, M., Meijer, A.H., Distel, M., Eisen, J.S., Guillemin, K. (2018) Microbiota promote secretory cell determination in the intestinal epithelium by modulating host Notch signaling. Development (Cambridge, England). 145(4)
- Rolig, A.S., Mittge, E.K., Ganz, J., Troll, J.V., Melancon, E., Wiles, T.J., Alligood, K., Stephens, W.Z., Eisen, J.S., Guillemin, K. (2017) The enteric nervous system promotes intestinal health by constraining microbiota composition. PLoS Biology. 15:e2000689
- Smith, C.J., Wheeler, M.A., Marjoram, L., Bagnat, M., Deppmann, C.D., Kucenas, S. (2017) TNFa/TNFR2 signaling is required for glial ensheathment at the dorsal root entry zone. PLoS Genetics. 13:e1006712
- Berg, R.D., Levitte, S., O'Sullivan, M.P., O'Leary, S.M., Cambier, C.J., Cameron, J., Takaki, K.K., Moens, C.B., Tobin, D.M., Keane, J., Ramakrishnan, L. (2016) Lysosomal Disorders Drive Susceptibility to Tuberculosis by Compromising Macrophage Migration. Cell. 165:139-152
- Espín-Palazón, R., Martínez-López, A., Roca, F.J., López-Muñoz, A., Tyrkalska, S.D., Candel, S., García-Moreno, D., Falco, A., Meseguer, J., Estepa, A., Mulero, V. (2016) TNFα Impairs Rhabdoviral Clearance by Inhibiting the Host Autophagic Antiviral Response. PLoS pathogens. 12:e1005699
- Levitte, S., Adams, K.N., Berg, R.D., Cosma, C.L., Urdahl, K.B., Ramakrishnan, L. (2016) Mycobacterial Acid Tolerance Enables Phagolysosomal Survival and Establishment of Tuberculous Infection In Vivo. Cell Host & Microbe. 20:250-258
- Marjoram, L., Alvers, A., Deerhake, M.E., Bagwell, J., Mankiewicz, J., Cocchiaro, J.L., Beerman, R.W., Willer, J., Sumigray, K.D., Katsanis, N., Tobin, D.M., Rawls, J.F., Goll, M.G., Bagnat, M. (2015) Epigenetic control of intestinal barrier function and inflammation in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 112(9):2770-5
- Candel, S., de Oliveira, S., López-Muñoz, A., García-Moreno, D., Espín-Palazón, R., Tyrkalska, S.D., Cayuela, M.L., Renshaw, S.A., Corbalán-Vélez, R., Vidal-Abarca, I., Tsai, H.J., Meseguer, J., Sepulcre, M.P., Mulero, V. (2014) Tnfa signaling through tnfr2 protects skin against oxidative stress-induced inflammation. PLoS Biology. 12:e1001855
- Espín-Palazón, R., Stachura, D.L., Campbell, C.A., García-Moreno, D., Del Cid, N., Kim, A.D., Candel, S., Meseguer, J., Mulero, V., Traver, D. (2014) Proinflammatory signaling regulates hematopoietic stem cell emergence. Cell. 159:1070-85
- Espín, R., Roca, F.J., Candel, S., Sepulcre, M.P., González-Rosa, J.M., Alcaraz-Pérez, F., Meseguer, J., Cayuela, M.L., Mercader, N., and Mulero, V. (2013) TNF receptors regulate vascular homeostasis through a caspase-8, caspase-2 and P53 apoptotic program that bypasses caspase-3. Disease models & mechanisms. 6(2):383-396
1 - 10 of 13
Show