Morpholino
MO2-gata5
- ID
- ZDB-MRPHLNO-080325-5
- Name
- MO2-gata5
- Previous Names
- None
- Target
- Sequence
-
5' - AAGATAAAGCCAGGCTCGAATACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gata5
No data available
Phenotype
Phenotype resulting from MO2-gata5
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO2-gata5
1 - 5 of 7 Show all
Citations
- Wen, B., Yuan, H., Liu, X., Wang, H., Chen, S., Chen, Z., de The, H., Zhou, J., Zhu, J. (2017) GATA5 SUMOylation is indispensable for zebrafish cardiac development. Biochimica et biophysica acta. 1861(7):1691-1701
- Gupta, V., Gemberling, M., Karra, R., Rosenfeld, G.E., Evans, T., and Poss, K.D. (2013) An Injury-Responsive Gata4 Program Shapes the Zebrafish Cardiac Ventricle. Current biology : CB. 23(13):1221-7
- Novikov, N., and Evans, T. (2013) Tmem88a mediates GATA-dependent specification of cardiomyocyte progenitors by restricting WNT signaling. Development (Cambridge, England). 140(18):3787-98
- Torregroza, I., Holtzinger, A., Mendelson, K., Liu, T.C., Hla, T., and Evans, T. (2012) Regulation of a Vascular Plexus by gata4 Is Mediated in Zebrafish through the Chemokine sdf1a. PLoS One. 7(10):e46844
- Li, N., Wei, C., Olena, A.F., and Patton, J.G. (2011) Regulation of endoderm formation and left-right asymmetry by miR-92 during early zebrafish development. Development (Cambridge, England). 138(9):1817-1826
- Holtzinger, A., and Evans, T. (2007) Gata5 and Gata6 are functionally redundant in zebrafish for specification of cardiomyocytes. Developmental Biology. 312(2):613-622
1 - 6 of 6
Show