Morpholino
MO1-epor
- ID
- ZDB-MRPHLNO-080325-2
- Name
- MO1-epor
- Previous Names
- None
- Target
- Sequence
-
5' - AACTGGGCCACTGAACAATCAAATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino could not be confirmed to hit epor on Zv7. It does hit in the region suggesting an assembly error.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-epor
No data available
Phenotype
Phenotype resulting from MO1-epor
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-epor
1 - 5 of 15 Show all
Citations
- She, J., Yuan, Z., Wu, Y., Chen, J., Kroll, J. (2017) Targeting erythropoietin protects against proteinuria in type 2 diabetic patients and in zebrafish. Molecular metabolism. 8:189-202
- Lim, K.H., Chang, Y.C., Chiang, Y.H., Lin, H.C., Chang, C.Y., Lin, C.S., Huang, L., Wang, W.T., Gon-Shen Chen, C., Chou, W.C., Kuo, Y.Y. (2016) Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish. Blood cancer journal. 6:e481
- Paffett-Lugassy, N., Hsia, N., Fraenkel, P.G., Paw, B., Leschinsky, I., Barut, B., Bahary, N., Caro, J., Handin, R., and Zon, L.I. (2007) Functional conservation of erythropoietin signaling in zebrafish. Blood. 110(7):2718-2726
1 - 3 of 3
Show