Morpholino
MO1-crkl
- ID
- ZDB-MRPHLNO-080109-3
- Name
- MO1-crkl
- Previous Names
-
- crkl ATG (1)
- Target
- Sequence
-
5' - AGGAGTCGAACCGTGCAGACGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation blocker - targeted to ATG
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-crkl
No data available
Phenotype
Phenotype resulting from MO1-crkl
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-crkl
1 - 5 of 10 Show all
Citations
- Lopez-Rivera, E., Liu, Y.P., Verbitsky, M., Anderson, B.R., Capone, V.P., Otto, E.A., Yan, Z., Mitrotti, A., Martino, J., Steers, N.J., Fasel, D.A., Vukojevic, K., Deng, R., Racedo, S.E., Liu, Q., Werth, M., Westland, R., Vivante, A., Makar, G.S., Bodria, M., Sampson, M.G., Gillies, C.E., Vega-Warner, V., Maiorana, M., Petrey, D.S., Honig, B., Lozanovski, V.J., Salomon, R., Heidet, L., Carpentier, W., Gaillard, D., Carrea, A., Gesualdo, L., Cusi, D., Izzi, C., Scolari, F., van Wijk, J.A., Arapovic, A., Saraga-Babic, M., Saraga, M., Kunac, N., Samii, A., McDonald-McGinn, D.M., Crowley, T.B., Zackai, E.H., Drozdz, D., Miklaszewska, M., Tkaczyk, M., Sikora, P., Szczepanska, M., Mizerska-Wasiak, M., Krzemien, G., Szmigielska, A., Zaniew, M., Darlow, J.M., Puri, P., Barton, D., Casolari, E., Furth, S.L., Warady, B.A., Gucev, Z., Hakonarson, H., Flogelova, H., Tasic, V., Latos-Bielenska, A., Materna-Kiryluk, A., Allegri, L., Wong, C.S., Drummond, I.A., D'Agati, V., Imamoto, A., Barasch, J.M., Hildebrandt, F., Kiryluk, K., Lifton, R.P., Morrow, B.E., Jeanpierre, C., Papaioannou, V.E., Ghiggeri, G.M., Gharavi, A.G., Katsanis, N., Sanna-Cherchi, S. (2017) Genetic Drivers of Kidney Defects in the DiGeorge Syndrome. The New England Journal of Medicine. 376(8):742-754
- Moore, C.A., Parkin, C.A., Bidet, Y., and Ingham, P.W. (2007) A role for the Myoblast city homologues Dock1 and Dock5 and the adaptor proteins Crk and Crk-like in zebrafish myoblast fusion. Development (Cambridge, England). 134(17):3145-3153
1 - 2 of 2
Show