Morpholino

MO1-ctr9

ID
ZDB-MRPHLNO-071219-5
Name
MO1-ctr9
Previous Names
None
Target
Sequence
5' - GATTTCAATGGATCCCCGAGACATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ctr9
Expressed Gene Anatomy Figures
crestin Fig. 1 from Santoriello et al., 2020
Fig. S5 from Akanuma et al., 2007
ctr9 Fig. s3 with image from Langenbacher et al., 2011
gata4 Fig. 5 with image from Langenbacher et al., 2011
gata5 Fig. 5 with image from Langenbacher et al., 2011
hand2 Fig. 5 with image from Langenbacher et al., 2011
hbbe3 Fig. 3 with image from Bai et al., 2010
her1 Fig. 4 from Akanuma et al., 2007
myl7 Fig. 3 with image from Langenbacher et al., 2011
nkx2.5 Fig. 3 with image from Langenbacher et al., 2011
tbx20 Fig. 5 with image from Langenbacher et al., 2011
Phenotype
Phenotype resulting from MO1-ctr9
Phenotype Fish Figures
cardiac cell fate specification process quality, abnormal WT + MO1-ctr9 Fig. 5 with image from Langenbacher et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-ctr9 Fig. 3 with image from Langenbacher et al., 2011
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal WT + MO1-ctr9 Fig. 3 with image from Langenbacher et al., 2011
embryonic heart tube morphogenesis disrupted, abnormal WT + MO1-ctr9 Fig. 3 with image from Langenbacher et al., 2011
heart development disrupted, abnormal WT + MO1-ctr9 Fig. 4 from Akanuma et al., 2007
myocardial precursor decreased amount, abnormal WT + MO1-ctr9 Fig. 3 with image from Langenbacher et al., 2011
neural crest crestin expression decreased amount, abnormal AB + MO1-ctr9 Fig. 1 from Santoriello et al., 2020
neural crest cell decreased amount, abnormal WT + MO1-ctr9 Fig. S5 from Akanuma et al., 2007
neural crest cell development disrupted, abnormal WT + MO1-ctr9 Fig. S5 from Akanuma et al., 2007
otic vesicle decreased size, abnormal WT + MO1-ctr9 Fig. 4 from Akanuma et al., 2007
pericardium edematous, abnormal WT + MO1-ctr9 Fig. s1 with image from Langenbacher et al., 2011
pigment cell absent, abnormal WT + MO1-ctr9 Fig. s1 with image from Langenbacher et al., 2011
pigmentation arrested, abnormal WT + MO1-ctr9 Fig. s1 with image from Langenbacher et al., 2011
post-vent region decreased length, abnormal WT + MO1-ctr9 Fig. 4 from Akanuma et al., 2007
post-vent region somite border disorganized, abnormal WT + MO1-ctr9 Fig. 4 from Akanuma et al., 2007
whole organism curved ventral, abnormal WT + MO1-ctr9 Fig. s1 with image from Langenbacher et al., 2011
Phenotype of all Fish created by or utilizing MO1-ctr9
Phenotype Fish Conditions Figures
neural crest crestin expression decreased amount, abnormal AB + MO1-ctr9 control Fig. 1 from Santoriello et al., 2020
neural crest crestin expression amount, ameliorated AB + MO1-ctr9 chemical treatment by environment: progesterone Fig. 1 from Santoriello et al., 2020
cardiac cell fate specification process quality, abnormal WT + MO1-ctr9 standard conditions Fig. 5 with image from Langenbacher et al., 2011
heart development disrupted, abnormal WT + MO1-ctr9 standard conditions Fig. 4 from Akanuma et al., 2007
otic vesicle decreased size, abnormal WT + MO1-ctr9 standard conditions Fig. 4 from Akanuma et al., 2007
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal WT + MO1-ctr9 standard conditions Fig. 3 with image from Langenbacher et al., 2011
pigmentation arrested, abnormal WT + MO1-ctr9 standard conditions Fig. s1 with image from Langenbacher et al., 2011
embryonic heart tube morphogenesis disrupted, abnormal WT + MO1-ctr9 standard conditions Fig. 3 with image from Langenbacher et al., 2011
neural crest cell decreased amount, abnormal WT + MO1-ctr9 standard conditions Fig. S5 from Akanuma et al., 2007
myocardial precursor decreased amount, abnormal WT + MO1-ctr9 standard conditions Fig. 3 with image from Langenbacher et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-ctr9 standard conditions Fig. 3 with image from Langenbacher et al., 2011
post-vent region somite border disorganized, abnormal WT + MO1-ctr9 standard conditions Fig. 4 from Akanuma et al., 2007
post-vent region decreased length, abnormal WT + MO1-ctr9 standard conditions Fig. 4 from Akanuma et al., 2007
pigment cell absent, abnormal WT + MO1-ctr9 standard conditions Fig. s1 with image from Langenbacher et al., 2011
whole organism curved ventral, abnormal WT + MO1-ctr9 standard conditions Fig. s1 with image from Langenbacher et al., 2011
neural crest cell development disrupted, abnormal WT + MO1-ctr9 standard conditions Fig. S5 from Akanuma et al., 2007
pericardium edematous, abnormal WT + MO1-ctr9 standard conditions Fig. s1 with image from Langenbacher et al., 2011
trunk somite border disorganized, abnormal rtf1kt641/kt641 + MO1-ctr9 standard conditions Fig. 4 from Akanuma et al., 2007
neural crest cell development disrupted, abnormal rtf1kt641/kt641 + MO1-ctr9 standard conditions Fig. S5 from Akanuma et al., 2007
neural crest cell decreased amount, abnormal rtf1kt641/kt641 + MO1-ctr9 standard conditions Fig. S5 from Akanuma et al., 2007
erythrocyte differentiation decreased occurrence, abnormal trim33tg234/tg234 + MO1-ctr9 standard conditions Fig. 3 with image from Bai et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.