Morpholino

MO1-six7

ID
ZDB-MRPHLNO-071205-1
Name
MO1-six7
Previous Names
None
Target
Sequence
5' - CCAACGGCATTCCAGTGTGAGTAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This MO targets the 5' UTR of six7.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-six7
Phenotype
Phenotype resulting from MO1-six7
Phenotype of all Fish created by or utilizing MO1-six7
Phenotype Fish Conditions Figures
retinal rod cell increased amount, abnormal WT + MO1-six7 standard conditions Fig. 2 with imageFig. 3 with image from Sotolongo-Lopez et al., 2016
retinal ganglion cell layer apoptotic process increased occurrence, abnormal WT + MO1-six7 standard conditions Fig. 3 with image from Sotolongo-Lopez et al., 2016
retinal inner nuclear layer apoptotic process increased occurrence, abnormal WT + MO1-six7 standard conditions Fig. 3 with image from Sotolongo-Lopez et al., 2016
retinal rod cell cell population proliferation increased occurrence, abnormal WT + MO1-six7 standard conditions Fig. 3 with image from Sotolongo-Lopez et al., 2016
retinal outer nuclear layer cell population proliferation temporally extended, abnormal WT + MO1-six7 standard conditions Fig. 3 with image from Sotolongo-Lopez et al., 2016
embryonic retina morphogenesis in camera-type eye disrupted, abnormal q16aTg; q16bTg + MO1-six7 standard conditions Fig. 8 from Saade et al., 2013
retinal outer nuclear layer retinal rod cell increased amount, abnormal q16aTg; q16bTg + MO1-six7 standard conditions Fig. 8 from Saade et al., 2013
eye aplastic, abnormal six3bvu87/vu87 + MO1-six7 standard conditions Fig. 1 with image from Geng et al., 2008
parapineal organ right side of epiphysis, abnormal six3bvu87/vu87 + MO1-six7(AB) standard conditions Fig. 1 with image from Inbal et al., 2007
optic stalk decreased size, abnormal six3bvu87/vu87 + MO1-six7(AB) standard conditions Fig. 1 with image from Inbal et al., 2007
habenula asymmetrical, abnormal six3bvu87/vu87 + MO1-six7(AB) standard conditions Fig. 1 with image from Inbal et al., 2007
eye aplastic, abnormal six3bvu87/vu87 + MO1-six7(AB) standard conditions Fig. 1 with image from Inbal et al., 2007
parapineal organ mislocalised anteriorly, abnormal six3bvu87/vu87 + MO1-six7(AB) standard conditions Fig. 1 with image from Inbal et al., 2007
Citations