Morpholino

MO3-tbxta

ID
ZDB-MRPHLNO-071130-1
Name
MO3-tbxta
Previous Names
  • MO3-ntl
  • MO3-ta
Target
Sequence
5' - GACTTGAGGCAGACATATTTCCGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Published as a photoactivatable morpholino. A photo-cleavable version of this MO was described in Tallafuss et al. 2012 (ZDB-PUB-120412-12). MO nucleotide 13 (A) was replaced by a photo-sensitive subunit.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tbxta
Expressed Gene Anatomy Figures
myh9a Fig. 4 with image from Veerkamp et al., 2013
Phenotype
Phenotype resulting from MO3-tbxta
Phenotype of all Fish created by or utilizing MO3-tbxta
Citations