Morpholino
MO3-tbxta
- ID
- ZDB-MRPHLNO-071130-1
- Name
- MO3-tbxta
- Previous Names
-
- MO3-ntl
- MO3-ta
- Target
- Sequence
-
5' - GACTTGAGGCAGACATATTTCCGAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Published as a photoactivatable morpholino. A photo-cleavable version of this MO was described in Tallafuss et al. 2012 (ZDB-PUB-120412-12). MO nucleotide 13 (A) was replaced by a photo-sensitive subunit. A caged version of this morpholino was described in Darrah et al., 2021( ZDB-PUB-211028-5). A self-transfecting guanidinium linked morpholino (GMO) was described in Das et al., 2023 ZDB-PUB-230420-69.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tbxta
No data available
Phenotype
Phenotype resulting from MO3-tbxta
Phenotype of all Fish created by or utilizing MO3-tbxta
1 - 5 of 7 Show all
Citations
- Das, U., Kundu, J., Shaw, P., Bose, C., Ghosh, A., Gupta, S., Sarkar, S., Bhadra, J., Sinha, S. (2023) Self-transfecting GMO-PMO chimera targeting Nanog enable gene silencing in vitro and suppresses tumor growth in 4T1 allografts in mouse. Molecular therapy. Nucleic acids. 32:203228203-228
- Kundu, J., Ghosh, A., Ghosh, U., Das, A., Nagar, D., Pattanayak, S., Ghose, A., Sinha, S. (2022) Synthesis of Phosphorodiamidate Morpholino Oligonucleotides Using Trityl and Fmoc Chemistry in an Automated Oligo Synthesizer. The Journal of organic chemistry. 87(15):9466-9478
- Pattanayak, S., Sarode, B.R., Deiters, A., Chen, J.K. (2022) Bicyclic Caged Morpholino Oligonucleotides for Optical Gene Silencing. Chembiochem : a European journal of chemical biology. 23(21):e202200374
- Darrah, K., Wesalo, J., Lukasak, B., Tsang, M., Chen, J.K., Deiters, A. (2021) Small Molecule Control of Morpholino Antisense Oligonucleotide Function through Staudinger Reduction. Journal of the American Chemical Society. 143(44):18665-18671
- Ye, Z., Kimelman, D. (2020) hox13 genes are required for mesoderm formation and axis elongation during early zebrafish development. Development (Cambridge, England). 147(22):
- Bhadra, J., Pattanayak, S., Khan, P.P., Kundu, J., Sinha, S. (2016) Internal Oligoguanidinium-based Cellular Transporter Enhances Antisense Efficacy of Morpholinos in in vitro and Zebrafish model. Bioconjugate Chemistry. 27(10):2254-2259
- Payumo, A.Y., Walker, W.J., McQuade, L.E., Yamazoe, S., Chen, J.K. (2015) Optochemical Dissection of T-box Gene-Dependent Medial Floor Plate Development. ACS Chemical Biology. 10(6):1466-75
- Yamazoe, S., Liu, Q., McQuade, L.E., Deiters, A., Chen, J.K. (2014) Sequential Gene Silencing Using Wavelength-Selective Caged Morpholino Oligonucleotides. Angewandte Chemie (International ed. in English). 53(38):10114-8
- Yamazoe, S., McQuade, L.E., Chen, J.K. (2014) Nitroreductase-Activatable Morpholino Oligonucleotides for in Vivo Gene Silencing. ACS Chemical Biology. 9(9):1985-90
- Veerkamp, J., Rudolph, F., Cseresnyes, Z., Priller, F., Otten, C., Renz, M., Schaefer, L., and Abdelilah-Seyfried, S. (2013) Unilateral dampening of bmp activity by nodal generates cardiac left-right asymmetry. Developmental Cell. 24(6):660-667
1 - 10 of 19
Show