Morpholino
MO1-mir206-1
- ID
- ZDB-MRPHLNO-071112-1
- Name
- MO1-mir206-1
- Previous Names
- Target
- Sequence
-
5' - CCACACACTTCCTTACATTCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir206-1
No data available
Phenotype
Phenotype resulting from MO1-mir206-1
No data available
Phenotype of all Fish created by or utilizing MO1-mir206-1
1 - 4 of 4
Citations
- Mishima, Y., Fukao, A., Kishimoto, T., Sakamoto, H., Fujiwara, T., and Inoue, K. (2012) Translational inhibition by deadenylation-independent mechanisms is central to microRNA-mediated silencing in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 109(4):1104-1109
- Stahlhut, C., Suárez, Y., Lu, J., Mishima, Y., and Giraldez, A.J. (2012) miR-1 and miR-206 regulate angiogenesis by modulating VegfA expression in zebrafish. Development (Cambridge, England). 139(23):4356-4365
- Mishima, Y., Abreu-Goodger, C., Staton, A.A., Stahlhut, C., Shou, C., Cheng, C., Gerstein, M., Enright, A.J., and Giraldez, A.J. (2009) Zebrafish miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. Genes & Development. 23(5):619-632
- Kloosterman, W.P., Lagendijk, A.K., Ketting, R.F., Moulton, J.D., and Plasterk, R.H. (2007) Targeted Inhibition of miRNA Maturation with Morpholinos Reveals a Role for miR-375 in Pancreatic Islet Development. PLoS Biology. 5(8):e203
1 - 4 of 4
Show