Morpholino
MO3-nkx2.2a
- ID
- ZDB-MRPHLNO-070622-3
- Name
- MO3-nkx2.2a
- Previous Names
- None
- Target
- Sequence
-
5' - TGGAGCATTTGATGCAGTCAAGTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
against a part of the 52UTR common to both nkx2.2a mRNA variants and upstream of the start codon
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nkx2.2a
No data available
Phenotype
Phenotype resulting from MO3-nkx2.2a
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO3-nkx2.2a
1 - 5 of 10 Show all
Citations
- Anderson, K.R., Singer, R.A., Balderes, D.A., Hernandez-Lagunas, L., Johnson, C.W., Artinger, K.B., and Sussel, L. (2011) The L6 domain tetraspanin Tm4sf4 regulates endocrine pancreas differentiation and directed cell migration. Development (Cambridge, England). 138(15):3213-3224
- Ragvin, A., Moro, E., Fredman, D., Navratilova, P., Drivenes, O., Engström, P.G., Alonso, M.E., Mustienes, E.D., Gomez Skarmeta, J.L., Tavares, M.J., Casares, F., Manzanares, M., van Heyningen, V., Molven, A., Njølstad, P.R., Argenton, F., Lenhard, B., and Becker, T.S. (2010) Long-range gene regulation links genomic type 2 diabetes and obesity risk regions to HHEX, SOX4, and IRX3. Proceedings of the National Academy of Sciences of the United States of America. 107(2):775-780
- Pauls, S., Zecchin, E., Tiso, N., Bortolussi, M., and Argenton, F. (2007) Function and regulation of zebrafish nkx2.2a during development of pancreatic islet and ducts. Developmental Biology. 304(2):875-890
1 - 3 of 3
Show