Morpholino

MO5-notch1a

ID

ZDB-MRPHLNO-070622-1

Name

MO5-notch1a

Previous Names

None

Target

notch1a (1)

Sequence

5' - GTAGTGTTAAACTGTTACCTTGTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

blocks splicing at exon1-intron1 boundary

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-notch1a

No data available

Phenotype

Phenotype resulting from MO5-notch1a

Phenotype	Fish	Figures
dorsal aorta development process quality, abnormal	AB + MO5-notch1a	Fig. S4 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal	AB + MO5-notch1a	Fig. S4 from Kim et al., 2014
hindbrain has extra parts of type Mauthner neuron, abnormal	ue1Tg; ue2Tg + MO5-notch1a	Fig. 1 from Almeida et al., 2018
spinal cord anterior region has extra parts of type Mauthner neuron axon, abnormal	ue1Tg; ue2Tg + MO5-notch1a	Fig. 1 from Almeida et al., 2018
vasculature development process quality, abnormal	AB + MO5-notch1a	Fig. S4 from Kim et al., 2014

Phenotype of all Fish created by or utilizing MO5-notch1a

Phenotype	Fish	Conditions	Figures
hematopoietic progenitor cell differentiation process quality, abnormal	AB + MO5-notch1a	standard conditions	Fig. S4 from Kim et al., 2014
dorsal aorta development process quality, abnormal	AB + MO5-notch1a	standard conditions	Fig. S4 from Kim et al., 2014
vasculature development process quality, abnormal	AB + MO5-notch1a	standard conditions	Fig. S4 from Kim et al., 2014
hindbrain has extra parts of type Mauthner neuron, abnormal	ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
spinal cord anterior region has extra parts of type Mauthner neuron axon, abnormal	ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, exacerbated	WT + MO2-tnfrsf1b + MO5-notch1a	standard conditions	Fig. 4 from Espín-Palazón et al., 2014
hindbrain has extra parts of type Mauthner neuron, abnormal	kifbp^st23/st23; ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
oligodendrocyte myelin sheath separated from neuron cell body, ameliorated	kifbp^st23/st23; ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
spinal cord anterior region has extra parts of type Mauthner neuron axon, abnormal	kifbp^st23/st23; ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018
oligodendrocyte myelin sheath distal to neuron cell body, ameliorated	kifbp^st23/st23; ue1Tg; ue2Tg + MO5-notch1a	standard conditions	Fig. 1 from Almeida et al., 2018

Citations