Morpholino

MO9-pkd2

ID
ZDB-MRPHLNO-070620-5
Name
MO9-pkd2
Previous Names
  • cup augMO (1)
Target
Sequence
5' - AGCTCATCGTGTATTTCTACAGTAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO9-pkd2
No data available
Phenotype
Phenotype resulting from MO9-pkd2
Phenotype Fish Figures
determination of left/right symmetry process quality, abnormal WT + MO9-pkd2 Fig. 5 with image,  Fig. Table 1 with image from Schottenfeld et al., 2007
heart tube embryonic heart tube left/right pattern formation process quality, abnormal AB + MO9-pkd2 Figure 5 with image from Oliveira et al., 2021
Kupffer's vesicle GFP expression increased amount, abnormal pd1041Tg + MO9-pkd2 (AB) Figure 3 with image,  Figure 4 with image from Oliveira et al., 2021
Kupffer's vesicle GFP expression increased distribution, abnormal pd1041Tg + MO9-pkd2 (AB) Figure 3 with image from Oliveira et al., 2021
Kupffer's vesicle increased volume, abnormal s870Tg + MO9-pkd2 (AB) Figure 5 with image from Oliveira et al., 2021
Kupffer's vesicle apical plasma membrane GFP expression increased amount, abnormal pd1041Tg + MO9-pkd2 (AB) Figure 3 with image from Oliveira et al., 2021
Kupffer's vesicle apical plasma membrane GFP expression increased distribution, abnormal pd1041Tg + MO9-pkd2 (AB) Figure 3 with image from Oliveira et al., 2021
Kupffer's vesicle ciliary basal body ab2-pkd2 labeling decreased distribution, abnormal AB + MO9-pkd2 Figure 1 with image from Oliveira et al., 2021
Kupffer's vesicle ciliary membrane ab2-pkd2 labeling decreased distribution, abnormal AB + MO9-pkd2 Figure 1 with image from Oliveira et al., 2021
post-vent region curved, abnormal AB + MO9-pkd2 Figure 5 with image from Oliveira et al., 2021
Fig. 5 with image from Schottenfeld et al., 2007
Phenotype of all Fish created by or utilizing MO9-pkd2
Phenotype Fish Conditions Figures
post-vent region curved, abnormal AB + MO9-pkd2 control Figure 5 with image from Oliveira et al., 2021
Kupffer's vesicle ciliary basal body ab2-pkd2 labeling decreased distribution, abnormal AB + MO9-pkd2 control Figure 1 with image from Oliveira et al., 2021
post-vent region curved, abnormal AB + MO9-pkd2 chemical treatment by environment: tolvaptan Figure 5 with image from Oliveira et al., 2021
heart tube embryonic heart tube left/right pattern formation process quality, abnormal AB + MO9-pkd2 chemical treatment by environment: tolvaptan Figure 5 with image from Oliveira et al., 2021
Kupffer's vesicle ciliary membrane ab2-pkd2 labeling decreased distribution, abnormal AB + MO9-pkd2 control Figure 1 with image from Oliveira et al., 2021
heart tube embryonic heart tube left/right pattern formation process quality, abnormal AB + MO9-pkd2 control Figure 5 with image from Oliveira et al., 2021
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
heart mislocalised, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle motile cilium pkd2 expression absent, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle development process quality, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 4 with image from Roxo-Rosa et al., 2015
post-vent region curved dorsal, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle cytoplasm pkd2 expression decreased amount, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle increased area, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 4 with image from Roxo-Rosa et al., 2015
determination of left/right symmetry process quality, abnormal WT + MO9-pkd2 standard conditions Fig. 5 with image,  Fig. Table 1 with image from Schottenfeld et al., 2007
post-vent region curved, abnormal WT + MO9-pkd2 standard conditions Fig. 5 with image from Schottenfeld et al., 2007
Kupffer's vesicle GFP expression increased amount, abnormal pd1041Tg + MO9-pkd2 (AB) control Figure 3 with image,  Figure 4 with image from Oliveira et al., 2021
Kupffer's vesicle apical plasma membrane GFP expression increased amount, abnormal pd1041Tg + MO9-pkd2 (AB) control Figure 3 with image from Oliveira et al., 2021
Kupffer's vesicle apical plasma membrane GFP expression increased distribution, abnormal pd1041Tg + MO9-pkd2 (AB) control Figure 3 with image from Oliveira et al., 2021
Kupffer's vesicle GFP expression increased distribution, abnormal pd1041Tg + MO9-pkd2 (AB) control Figure 3 with image from Oliveira et al., 2021
Kupffer's vesicle increased volume, abnormal s870Tg + MO9-pkd2 (AB) control Figure 5 with image from Oliveira et al., 2021
Kupffer's vesicle volume, ameliorated vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: ouabain Fig. S2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle development process quality, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: forskolin, chemical treatment: 3-isobutyl-1-methyl-7H-xanthine Fig. 2 with image,  Fig. 3 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle increased volume, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: forskolin, chemical treatment: 3-isobutyl-1-methyl-7H-xanthine Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle decreased volume, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: CFTRinh-172 Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle epithelial cell 3-D shape, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: forskolin, chemical treatment: 3-isobutyl-1-methyl-7H-xanthine Fig. 3 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle development process quality, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 control Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle apical part of cell increased area, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: forskolin, chemical treatment: 3-isobutyl-1-methyl-7H-xanthine Fig. 3 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle development process quality, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: CFTRinh-172 Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle increased volume, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 control Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle decreased volume, abnormal vu119Tg + MO3-pkd2 + MO4-cftr + MO9-pkd2 control Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle development process quality, abnormal vu119Tg + MO3-pkd2 + MO4-cftr + MO9-pkd2 control Fig. 2 with image from Roxo-Rosa et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.