Morpholino
MO4-jag1b
- ID
- ZDB-MRPHLNO-070615-1
- Name
- MO4-jag1b
- Previous Names
-
- jagged1b-MO (1)
- Target
- Sequence
-
5' - AAATCAAGACTCACCGTCGTCCGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-jag1b
No data available
Phenotype
Phenotype resulting from MO4-jag1b
No data available
Phenotype of all Fish created by or utilizing MO4-jag1b
No data available
Citations
- Gwak, J.W., Kong, H.J., Bae, Y.K., Kim, M.J., Lee, J., Park, J.H., and Yeo, S.Y. (2010) Proliferating neural progenitors in the developing CNS of zebrafish require Jagged2 and Jagged1b. Molecules and cells. 30(2):155-159
- Yamamoto, M., Morita, R., Mizoguchi, T., Matsuo, H., Isoda, M., Ishitani, T., Chitnis, A.B., Matsumoto, K., Crump, J.G., Hozumi, K., Yonemura, S., Kawakami, K., and Itoh, M. (2010) Mib-Jag1-Notch signalling regulates patterning and structural roles of the notochord by controlling cell-fate decisions. Development (Cambridge, England). 137(15):2527-2537
- Yeo, S.Y., and Chitnis, A.B. (2007) Jagged-mediated Notch signaling maintains proliferating neural progenitors and regulates cell diversity in the ventral spinal cord. Proceedings of the National Academy of Sciences of the United States of America. 104(14):5913-5918
1 - 3 of 3
Show