Morpholino

MO1-cdh6

ID
ZDB-MRPHLNO-070602-1
Name
MO1-cdh6
Previous Names
None
Target
Sequence
5' - AAGAAGTACAATCCAAGTCCTCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdh6
Expressed Gene Anatomy Figures
alcama Fig. 8 from Liu et al., 2008
cdh6 Fig. 2 from Liu et al., 2008
crx Fig. 6 from Liu et al., 2008
pax2a Fig. 3,  Fig. 4 from Kubota et al., 2007
rx1 Fig. 6 from Liu et al., 2008
wt1a Fig. 3,  Fig. 4 from Kubota et al., 2007
Phenotype
Phenotype resulting from MO1-cdh6
Phenotype Fish Figures
cell differentiation disrupted, abnormal WT + MO1-cdh6 Fig. 8,  Fig. 9 from Liu et al., 2008
cell population proliferation disrupted, abnormal WT + MO1-cdh6 Fig. 5 from Liu et al., 2008
cranial nerve II morphology, abnormal WT + MO1-cdh6 Fig. 8 from Liu et al., 2008
extension decreased length, abnormal WT + MO1-cdh6 Fig. 3 from Liu et al., 2008
Fig. 2 from Kubota et al., 2007
eye decreased size, abnormal WT + MO1-cdh6 Fig. 3,  Fig. 6,  Fig. 7 from Liu et al., 2008
Fig. 2 from Kubota et al., 2007
eye photoreceptor cell decreased amount, abnormal WT + MO1-cdh6 Fig. 11 from Liu et al., 2008
head decreased size, abnormal WT + MO1-cdh6 Fig. 3 from Liu et al., 2008
Fig. 2 from Kubota et al., 2007
pericardium edematous, abnormal WT + MO1-cdh6 Fig. 3 from Liu et al., 2008
post-vent region bent, abnormal WT + MO1-cdh6 Fig. 2 from Kubota et al., 2007
post-vent region decreased length, abnormal WT + MO1-cdh6 Fig. 2 from Kubota et al., 2007
pronephric glomerulus structure, abnormal WT + MO1-cdh6 Fig. 3 from Kubota et al., 2007
pronephric glomerulus unfused from pronephric glomerulus, abnormal WT + MO1-cdh6 Fig. 3 from Kubota et al., 2007
pronephros epithelial cell morphology, abnormal WT + MO1-cdh6 Fig. 4 from Kubota et al., 2007
pronephros development disrupted, abnormal WT + MO1-cdh6 Fig. 3 from Kubota et al., 2007
retina morphology, abnormal WT + MO1-cdh6 Fig. 5 from Liu et al., 2008
retina structure, abnormal WT + MO1-cdh6 Fig. 7 from Liu et al., 2008
retina layer formation delayed, abnormal WT + MO1-cdh6 Fig. 7 from Liu et al., 2008
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-cdh6 Fig. 8,  Fig. 9 from Liu et al., 2008
retinal ganglion cell layer morphology, abnormal WT + MO1-cdh6 Fig. 8,  Fig. 9 from Liu et al., 2008
retinal inner nuclear layer morphology, abnormal WT + MO1-cdh6 Fig. 9 from Liu et al., 2008
retinal outer nuclear layer morphology, abnormal WT + MO1-cdh6 Fig. 11 from Liu et al., 2008
whole organism edematous, abnormal WT + MO1-cdh6 Fig. 2 from Kubota et al., 2007
whole organism increased curvature, abnormal WT + MO1-cdh6 Fig. 2 from Kubota et al., 2007
Phenotype of all Fish created by or utilizing MO1-cdh6
Phenotype Fish Conditions Figures
retina layer formation delayed, abnormal WT + MO1-cdh6 standard conditions Fig. 7 from Liu et al., 2008
whole organism edematous, abnormal WT + MO1-cdh6 standard conditions Fig. 2 from Kubota et al., 2007
extension decreased length, abnormal WT + MO1-cdh6 standard conditions Fig. 3 from Liu et al., 2008
Fig. 2 from Kubota et al., 2007
retinal outer nuclear layer morphology, abnormal WT + MO1-cdh6 standard conditions Fig. 11 from Liu et al., 2008
cell differentiation disrupted, abnormal WT + MO1-cdh6 standard conditions Fig. 8,  Fig. 9 from Liu et al., 2008
eye photoreceptor cell decreased amount, abnormal WT + MO1-cdh6 standard conditions Fig. 11 from Liu et al., 2008
post-vent region decreased length, abnormal WT + MO1-cdh6 standard conditions Fig. 2 from Kubota et al., 2007
retinal ganglion cell layer morphology, abnormal WT + MO1-cdh6 standard conditions Fig. 8,  Fig. 9 from Liu et al., 2008
head decreased size, abnormal WT + MO1-cdh6 standard conditions Fig. 3 from Liu et al., 2008
Fig. 2 from Kubota et al., 2007
pronephros epithelial cell morphology, abnormal WT + MO1-cdh6 standard conditions Fig. 4 from Kubota et al., 2007
retina structure, abnormal WT + MO1-cdh6 standard conditions Fig. 7 from Liu et al., 2008
pericardium edematous, abnormal WT + MO1-cdh6 standard conditions Fig. 3 from Liu et al., 2008
pronephros development disrupted, abnormal WT + MO1-cdh6 standard conditions Fig. 3 from Kubota et al., 2007
whole organism increased curvature, abnormal WT + MO1-cdh6 standard conditions Fig. 2 from Kubota et al., 2007
post-vent region bent, abnormal WT + MO1-cdh6 standard conditions Fig. 2 from Kubota et al., 2007
pronephric glomerulus unfused from pronephric glomerulus, abnormal WT + MO1-cdh6 standard conditions Fig. 3 from Kubota et al., 2007
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-cdh6 standard conditions Fig. 8,  Fig. 9 from Liu et al., 2008
retinal inner nuclear layer morphology, abnormal WT + MO1-cdh6 standard conditions Fig. 9 from Liu et al., 2008
pronephric glomerulus structure, abnormal WT + MO1-cdh6 standard conditions Fig. 3 from Kubota et al., 2007
cranial nerve II morphology, abnormal WT + MO1-cdh6 standard conditions Fig. 8 from Liu et al., 2008
retina morphology, abnormal WT + MO1-cdh6 standard conditions Fig. 5 from Liu et al., 2008
eye decreased size, abnormal WT + MO1-cdh6 standard conditions Fig. 3,  Fig. 6,  Fig. 7 from Liu et al., 2008
Fig. 2 from Kubota et al., 2007
cell population proliferation disrupted, abnormal WT + MO1-cdh6 standard conditions Fig. 5 from Liu et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.