Morpholino
MO3-zic2a
- ID
- ZDB-MRPHLNO-070522-3
- Name
- MO3-zic2a
- Previous Names
- Target
- Sequence
-
5' - CTCACCTGAGAAGGAAAACATCATA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
intron 1 / exon 2 splice-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-zic2a
No data available
Phenotype
Phenotype resulting from MO3-zic2a
1 - 5 of 32 Show all
Phenotype of all Fish created by or utilizing MO3-zic2a
1 - 5 of 76 Show all
Citations
- Drummond, D.L., Cheng, C.S., Selland, L.G., Hocking, J.C., Prichard, L.B., and Waskiewicz, A.J. (2013) The role of Zic transcription factors in regulating hindbrain retinoic acid signaling. BMC Developmental Biology. 13:31
- Teslaa, J.J., Keller, A.N., Nyholm, M.K., and Grinblat, Y. (2013) Zebrafish Zic2a and Zic2b regulate neural crest and craniofacial development. Developmental Biology. 380(1):73-86
- Nyholm, M.K., Abdelilah-Seyfried, S., and Grinblat, Y. (2009) A novel genetic mechanism regulates dorsolateral hinge-point formation during zebrafish cranial neurulation. Journal of Cell Science. 122(Pt 12):2137-2148
- Sanek, N.A., Taylor, A.A., Nyholm, M.K., and Grinblat, Y. (2009) Zebrafish zic2a patterns the forebrain through modulation of Hedgehog-activated gene expression. Development (Cambridge, England). 136(22):3791-3800
- Sanek, N.A., and Grinblat, Y. (2008) A novel role for zebrafish zic2a during forebrain development. Developmental Biology. 317(1):325-335
- Nyholm, M.K., Wu, S.F., Dorsky, R.I., and Grinblat, Y. (2007) The zebrafish zic2a-zic5 gene pair acts downstream of canonical Wnt signaling to control cell proliferation in the developing tectum. Development (Cambridge, England). 134(4):735-746
1 - 6 of 6
Show