Morpholino

MO3-zic2a

ID
ZDB-MRPHLNO-070522-3
Name
MO3-zic2a
Previous Names
  • 2MOC (1)
  • zic2aMO (1)
Target
Sequence
5' - CTCACCTGAGAAGGAAAACATCATA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
intron 1 / exon 2 splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-zic2a
Expressed Gene Anatomy Figures
aldh1a3 Fig. 6 with image from Sanek et al., 2009
arxa Fig. 4 with image from Sanek et al., 2009
Fig. 1 with image,  Fig. 4 with image from Sanek et al., 2008
col2a1a Fig. 3 with image from Teslaa et al., 2013
dbx1a Fig. 2 with image from Sanek et al., 2008
dlx2a Fig. 7 with image,  Fig. 8 with image from Teslaa et al., 2013
Fig. 4 with image from Sanek et al., 2009
Fig. 2 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. S4 with image from Sanek et al., 2008
emx1 Fig. 2 with image from Sanek et al., 2008
eomesa Fig. S3 with image from Sanek et al., 2008
fezf2 Fig. S1 with image from Sanek et al., 2008
fgf8a Fig. 5 with image from Sanek et al., 2009
foxg1a Fig. 2 with image,  Fig. S3 with image,  Fig. S4 with image from Sanek et al., 2008
gch2 Fig. 6 with image from Teslaa et al., 2013
gli1 Fig. 7 with image from Sanek et al., 2008
gli2a Fig. 7 with image from Sanek et al., 2008
gli3 Fig. 7 with image from Sanek et al., 2008
irx1b Fig. 7 with image,  Fig. S1 with image from Sanek et al., 2008
isl1a Fig. 3 with image from Sanek et al., 2008
lef1 Fig. S3 with image from Sanek et al., 2008
lhx1a Fig. S3 with image from Sanek et al., 2008
mitfa Fig. 6 with image from Teslaa et al., 2013
nkx2.1 Fig. 2 with image from Sanek et al., 2008
nkx2.2a Fig. 7 with image from Sanek et al., 2008
nkx2.4b Fig. S3 with image from Sanek et al., 2008
otpb Fig. 3 with image from Sanek et al., 2008
oxt Fig. 3 with image from Sanek et al., 2008
pax2a Fig. 5 with image,  Fig. 6 with image,  Fig. 9 with image from Sanek et al., 2009
pax6a Fig. 6 with image from Sanek et al., 2009
Fig. 2 with image from Sanek et al., 2008
pitx2 Fig. 8 with image from Teslaa et al., 2013
ptch2 Fig. 7 with image from Sanek et al., 2008
rx3 Fig. 5 with image from Sanek et al., 2009
Fig. S1 with image,  Fig. S3 with image from Sanek et al., 2008
shha Fig. 2 with image,  Fig. 7 with image,  Fig. S4 with image from Sanek et al., 2008
sim1a Fig. 3 with image from Sanek et al., 2008
six3b Fig. 2 with image,  Fig. 3 with image from Sanek et al., 2009
Fig. S1 with image from Sanek et al., 2008
snai1b Fig. 4 with image from Teslaa et al., 2013
sox9a Fig. 3 with image from Teslaa et al., 2013
sox10 Fig. 5 with image from Teslaa et al., 2013
vax1 Fig. 5 with image from Sanek et al., 2009
wnt1 Fig. 7 with image from Nyholm et al., 2007
Phenotype
Phenotype resulting from MO3-zic2a
Phenotype Fish Figures
cranial neural crest mislocalised dorsally, abnormal WT + MO3-zic2a Fig. 5 with image from Teslaa et al., 2013
diencephalon development disrupted, abnormal AB + MO3-zic2a Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Sanek et al., 2008
embryonic neurocranium morphogenesis decreased process quality, abnormal WT + MO3-zic2a Fig. 3 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO3-zic2a Fig. 1 with image,  Fig. 3 with image,  Fig. 7 with image from Teslaa et al., 2013
ethmoid cartilage medial region absent, abnormal WT + MO3-zic2a Fig. 3 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO3-zic2a Fig. 8 with image from Teslaa et al., 2013
fourth ventricle malformed, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
head has fewer parts of type xanthoblast, abnormal WT + MO3-zic2a Fig. 6 with image from Teslaa et al., 2013
hindbrain malformed, abnormal WT + MO3-zic2a Fig. 7 with image from Nyholm et al., 2007
hypothalamus cellular quality, abnormal WT + MO3-zic2a Fig. 8 with image from Teslaa et al., 2013
midbrain malformed, abnormal WT + MO3-zic2a Fig. 7 with image from Nyholm et al., 2007
negative regulation of DNA-templated transcription disrupted, abnormal AB + MO3-zic2a Fig. 2 with image,  Fig. 3 with image from Sanek et al., 2009
neural crest cell migration decreased process quality, abnormal WT + MO3-zic2a Fig. 5 with image from Teslaa et al., 2013
neural tube malformed, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
neurocranial trabecula shortened, abnormal WT + MO3-zic2a Fig. 3 with image from Teslaa et al., 2013
neurogenesis disrupted, abnormal AB + MO3-zic2a Fig. 3 with image from Sanek et al., 2008
optic fissure closure incomplete, abnormal AB + MO3-zic2a Fig. 6 with image from Sanek et al., 2009
optic fissure malformed, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
pharyngeal arch cellular quality, abnormal WT + MO3-zic2a Fig. 3 with image from Teslaa et al., 2013
pharyngeal arch 1 decreased size, abnormal WT + MO3-zic2a Fig. 7 with image from Teslaa et al., 2013
pharyngeal arch 2 decreased size, abnormal WT + MO3-zic2a Fig. 7 with image from Teslaa et al., 2013
pharyngeal arch 2 malformed, abnormal WT + MO3-zic2a Fig. 1 with image from Teslaa et al., 2013
pharyngeal arch cartilage hypoplastic, abnormal WT + MO3-zic2a Fig. 1 with image from Teslaa et al., 2013
regulation of smoothened signaling pathway disrupted, abnormal AB + MO3-zic2a Fig. 3 with image from Sanek et al., 2009
retinal neural layer decreased size, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
stomodeum decreased size, abnormal WT + MO3-zic2a Fig. 8 with image from Teslaa et al., 2013
tectal ventricle malformed, abnormal WT + MO3-zic2a text only from Nyholm et al., 2007
trunk has fewer parts of type xanthoblast, abnormal WT + MO3-zic2a Fig. 6 with image from Teslaa et al., 2013
ventral mandibular arch malformed, abnormal WT + MO3-zic2a Fig. 1 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO3-zic2a Fig. 8 with image from Teslaa et al., 2013
ventral thalamus decreased size, abnormal AB + MO3-zic2a Fig. 1 with image,  Fig. 2 with image,  Fig. S3 with image,  Fig. S4 with image from Sanek et al., 2008
xanthophore differentiation decreased process quality, abnormal WT + MO3-zic2a Fig. 6 with image from Teslaa et al., 2013
Phenotype of all Fish created by or utilizing MO3-zic2a
Phenotype Fish Conditions Figures
diencephalon development disrupted, abnormal Df(Chr07)t4/t4 + MO3-zic2a standard conditions Fig. 5 with image from Sanek et al., 2008
diencephalon development disrupted, abnormal AB + MO3-zic2a chemical treatment: ethanol Fig. 6 with image from Sanek et al., 2008
ventral thalamus decreased size, abnormal AB + MO3-zic2a chemical treatment: ethanol Fig. 6 with image from Sanek et al., 2008
cell proliferation in forebrain disrupted, abnormal AB + MO3-zic2a chemical treatment: 5-bromo-2'-deoxyuridine Fig. 4 with image from Sanek et al., 2008
diencephalon development disrupted, abnormal AB + MO3-zic2a chemical treatment: ethanol, chemical treatment: Cyclopamine Fig. 6 with image from Sanek et al., 2008
ventral thalamus decreased size, abnormal AB + MO3-zic2a chemical treatment: ethanol, chemical treatment: Cyclopamine Fig. 6 with image from Sanek et al., 2008
optic fissure closure incomplete, abnormal AB + MO3-zic2a standard conditions Fig. 6 with image from Sanek et al., 2009
diencephalon development disrupted, abnormal AB + MO3-zic2a standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Sanek et al., 2008
ventral thalamus decreased size, abnormal AB + MO3-zic2a standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. S3 with image,  Fig. S4 with image from Sanek et al., 2008
negative regulation of DNA-templated transcription disrupted, abnormal AB + MO3-zic2a standard conditions Fig. 2 with image,  Fig. 3 with image from Sanek et al., 2009
neurogenesis disrupted, abnormal AB + MO3-zic2a standard conditions Fig. 3 with image from Sanek et al., 2008
regulation of smoothened signaling pathway disrupted, abnormal AB + MO3-zic2a standard conditions Fig. 3 with image from Sanek et al., 2009
neural crest cell migration decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
trunk has fewer parts of type xanthoblast, abnormal WT + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
head has fewer parts of type xanthoblast, abnormal WT + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
hypothalamus cellular quality, abnormal WT + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
pharyngeal arch 1 decreased size, abnormal WT + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
fourth ventricle malformed, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
tectal ventricle malformed, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
neurocranial trabecula shortened, abnormal WT + MO3-zic2a standard conditions Fig. 3 with image from Teslaa et al., 2013
midbrain malformed, abnormal WT + MO3-zic2a standard conditions Fig. 7 with image from Nyholm et al., 2007
ventral mandibular arch malformed, abnormal WT + MO3-zic2a standard conditions Fig. 1 with image from Teslaa et al., 2013
pharyngeal arch 2 malformed, abnormal WT + MO3-zic2a standard conditions Fig. 1 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
pharyngeal arch 2 decreased size, abnormal WT + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
retinal neural layer decreased size, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
cranial neural crest mislocalised dorsally, abnormal WT + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
hindbrain malformed, abnormal WT + MO3-zic2a standard conditions Fig. 7 with image from Nyholm et al., 2007
optic fissure malformed, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
ethmoid cartilage medial region absent, abnormal WT + MO3-zic2a standard conditions Fig. 3 with image from Teslaa et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 3 with image from Teslaa et al., 2013
pharyngeal arch cellular quality, abnormal WT + MO3-zic2a standard conditions Fig. 3 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
neural tube malformed, abnormal WT + MO3-zic2a standard conditions text only from Nyholm et al., 2007
pharyngeal arch cartilage hypoplastic, abnormal WT + MO3-zic2a standard conditions Fig. 1 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
stomodeum decreased size, abnormal WT + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO3-zic2a standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 7 with image from Teslaa et al., 2013
negative regulation of DNA-templated transcription disrupted, abnormal smob641/b641 + MO3-zic2a standard conditions Fig. 3 with image from Sanek et al., 2009
diencephalon development disrupted, abnormal smob641/b641 + MO3-zic2a standard conditions Fig. 5 with image from Sanek et al., 2008
regulation of smoothened signaling pathway disrupted, abnormal smob641/b641 + MO3-zic2a standard conditions Fig. 3 with image from Sanek et al., 2009
alar plate midbrain region apical junction complex patchy, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 4 from Nyholm et al., 2009
midbrain malformed, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2,  Fig. 6 from Nyholm et al., 2009
Fig. 7 with image,  Fig. 8 with image from Nyholm et al., 2007
cell proliferation in midbrain disrupted, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 9 with image from Nyholm et al., 2007
actin-myosin filament sliding decreased rate, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 3 from Nyholm et al., 2009
secondary neural tube formation process quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2 from Nyholm et al., 2009
tectal ventricle malformed, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2 from Nyholm et al., 2009
Fig. 7 with image,  Fig. 8 with image from Nyholm et al., 2007
tectal ventricle decreased size, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2 from Nyholm et al., 2009
hindbrain malformed, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 7 with image,  Fig. 8 with image from Nyholm et al., 2007
regulation of mitotic cell cycle, embryonic process quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 6 from Nyholm et al., 2009
alar plate midbrain region physical object quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 3 from Nyholm et al., 2009
midbrain development process quality, abnormal WT + MO1-zic5 + MO3-zic2a standard conditions Fig. 2,  Fig. 6 from Nyholm et al., 2009
ventral thalamus cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
melanoblast mislocalised, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
neural crest cell differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 4 with image from Teslaa et al., 2013
pharyngeal arch 1 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
melanocyte migration decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 2 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
neural crest cell cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 4 with image from Teslaa et al., 2013
neural crest cell migration decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
melanoblast aggregated, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
head has fewer parts of type melanoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
melanocyte differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
pharyngeal arch 3 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
cranial neural crest mislocalised dorsally, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
head has fewer parts of type xanthoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 4 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
trunk has fewer parts of type melanoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
hypothalamus cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
rhombomere 3 decreased size, abnormal WT + MO2-zic2b + MO2-zic3 + MO3-zic2a standard conditions Fig. 6 with image from Drummond et al., 2013
rhombomere 5 decreased size, abnormal WT + MO2-zic2b + MO2-zic3 + MO3-zic2a standard conditions Fig. 6 with image from Drummond et al., 2013
motor nucleus of vagal nerve anatomical region decreased size, abnormal rw0Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 10 with image from Drummond et al., 2013
retinoic acid receptor signaling pathway decreased process quality, abnormal sk71Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 8 with image from Drummond et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.