Morpholino
MO4-notch1b
- ID
- ZDB-MRPHLNO-070508-1
- Name
- MO4-notch1b
- Previous Names
-
- N1b-MO (1)
- Target
- Sequence
-
5' - ATCGTATAGTGGACTAGGAGAAAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-notch1b
No data available
Phenotype
Phenotype resulting from MO4-notch1b
| Phenotype | Fish | Figures |
|---|---|---|
| choroid plexus fourth ventricle increased size, abnormal | mn16Et + MO4-notch1b |
Fig. 5 
from Bill et al., 2008 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO4-notch1b
1 - 2 of 2
Citations
- So, J.H., Chun, H.S., Bae, Y.K., Kim, H.S., Park, Y.M., Huh, T.L., Chitnis, A.B., Kim, C.H., and Yeo, S.Y. (2009) Her4 is necessary for establishing peripheral projections of the trigeminal ganglia in zebrafish. Biochemical and Biophysical Research Communications. 379(1):22-26
- Bill, B.R., Balciunas, D., McCarra, J.A., Young, E.D., Xiong, T., Spahn, A.M., Garcia-Lecea, M., Korzh, V., Ekker, S.C., and Schimmenti, L.A. (2008) Development and notch signaling requirements of the zebrafish choroid plexus. PLoS One. 3(9):e3114
- Yeo, S.Y., Kim, M., Kim, H.S., Huh, T.L., and Chitnis, A.B. (2007) Fluorescent protein expression driven by her4 regulatory elements reveals the spatiotemporal pattern of Notch signaling in the nervous system of zebrafish embryos. Developmental Biology. 301(2):555-567
1 - 3 of 3
Show