Morpholino
MO1-epcam
- ID
- ZDB-MRPHLNO-070507-5
- Name
- MO1-epcam
- Previous Names
-
- MO1-epcam+zgc:110304
- MO1-tacstd+zgc:110304
- Target
- Sequence
-
5' - ACTAAAACCTTCATTGTGAGCGAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The sequence of this morpholino matches both epcam and zgc:110304.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-epcam
No data available
Phenotype
Phenotype resulting from MO1-epcam
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-epcam
1 - 5 of 5
Citations
- Neelathi, U.M., Dalle Nogare, D., Chitnis, A.B. (2018) Cxcl12a induces snail1b expression to initiate collective migration and sequential Fgf-dependent neuromast formation in the zebrafish posterior lateral line primordium.. Development (Cambridge, England). 145(14):
- Lu, H., Ma, J., Yang, Y., Shi, W., and Luo, L. (2013) EpCAM Is an Endoderm-Specific Wnt Derepressor that Licenses Hepatic Development. Developmental Cell. 24(5):543-553
- Villablanca, E.J., Renucci, A., Sapede, D., Lec, V., Soubiran, F., Sandoval, P.C., Dambly-Chaudiere, C., Ghysen, A., and Allende, M.L. (2006) Control of cell migration in the zebrafish lateral line: Implication of the gene "Tumour-Associated Calcium Signal Transducer," tacstd. Developmental Dynamics : an official publication of the American Association of Anatomists. 235(6):1578-1588
1 - 3 of 3
Show