Morpholino
MO1-atoh1b
- ID
- ZDB-MRPHLNO-070507-1
- Name
- MO1-atoh1b
- Previous Names
-
- atoh1b MO (1)
- Target
- Sequence
-
5' - TCATTGCTTGTGTAGAAATGCATAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atoh1b
No data available
Phenotype
Phenotype resulting from MO1-atoh1b
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-atoh1b
1 - 5 of 5
Citations
- Ezhkova, D., Schwarzer, S., Spieß, S., Geffarth, M., Machate, A., Zöller, D., Stucke, J., Alexopoulou, D., Lesche, M., Dahl, A., Hans, S. (2023) Transcriptome analysis reveals an Atoh1b-dependent gene set downstream of Dlx3b/4b during early inner ear development in zebrafish. Biology Open. 12(6):
- Stooke-Vaughan, G.A., Obholzer, N.D., Baxendale, S., Megason, S.G., Whitfield, T.T. (2015) Otolith tethering in the zebrafish otic vesicle requires Otogelin and α-Tectorin. Development (Cambridge, England). 142(6):1137-45
- Wang, J., Wu, Y., Zhao, F., Wu, Y., Dong, W., Zhao, J., Zhu, Z., Liu, D. (2015) Fgf-signaling-dependent sox9a and atoh1a regulate otic neural development in zebrafish. The Journal of neuroscience : the official journal of the Society for Neuroscience. 35:234-44
- Radosevic, M., Fargas, L., Alsina, B. (2014) The Role of her4 in Inner Ear Development and Its Relationship with Proneural Genes and Notch Signalling. PLoS One. 9:e109860
- Stooke-Vaughan, G.A., Huang, P., Hammond, K.L., Schier, A.F., and Whitfield, T.T. (2012) The role of hair cells, cilia and ciliary motility in otolith formation in the zebrafish otic vesicle. Development (Cambridge, England). 139(10):1777-1787
- Yu, X., Lau, D., Ng, C.P., and Roy, S. (2011) Cilia-driven fluid flow as an epigenetic cue for otolith biomineralization on sensory hair cells of the inner ear. Development (Cambridge, England). 138(3):487-494
- Matsuda, M., and Chitnis, A.B. (2010) Atoh1a expression must be restricted by Notch signaling for effective morphogenesis of the posterior lateral line primordium in zebrafish. Development (Cambridge, England). 137(20):3477-3487
- Millimaki, B.B., Sweet, E.M., and Riley, B.B. (2010) Sox2 is required for maintenance and regeneration, but not initial development, of hair cells in the zebrafish inner ear. Developmental Biology. 338(2):262-269
- Millimaki, B.B., Sweet, E.M., Dhason, M.S., and Riley, B.B. (2007) Zebrafish atoh1 genes: classic proneural activity in the inner ear and regulation by Fgf and Notch. Development (Cambridge, England). 134(2):295-305
1 - 9 of 9
Show