Morpholino
MO2-cyp26c1
- ID
- ZDB-MRPHLNO-070410-8
- Name
- MO2-cyp26c1
- Previous Names
- None
- Target
- Sequence
-
5' - GGAACCCTGTCACAACATAACAGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets intron-1–exon-2 junction. Morpholino toxic at higher concentrations.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cyp26c1
No data available
Phenotype
Phenotype resulting from MO2-cyp26c1
No data available
Phenotype of all Fish created by or utilizing MO2-cyp26c1
1 - 5 of 41 Show all
Citations
- Song, Y.C., Dohn, T.E., Rydeen, A.B., Nechiporuk, A.V., Waxman, J.S. (2019) HDAC1-mediated repression of the retinoic acid-responsive gene ripply3 promotes second heart field development. PLoS Genetics. 15:e1008165
- Rydeen, A.B., Waxman, J.S. (2016) Cyp26 Enzymes Facilitate Second Heart Field Progenitor Addition and Maintenance of Ventricular Integrity. PLoS Biology. 14:e2000504
- Rydeen, A.B., Waxman, J.S. (2014) Cyp26 enzymes are required to balance the cardiac and vascular lineages within the anterior lateral plate mesoderm. Development (Cambridge, England). 141:1638-48
- Hernandez, R.E., Putzke, A.P., Myers, J.P., Margaretha, L., and Moens, C.B. (2007) Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development. Development (Cambridge, England). 134(1):177-187
1 - 4 of 4
Show