Morpholino
MO1-cyp26b1
- ID
- ZDB-MRPHLNO-070410-1
- Name
- MO1-cyp26b1
- Previous Names
- None
- Target
- Sequence
-
5' - CTCGAAGAGCATGGCTGTGAACGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets start ATG.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cyp26b1
No data available
Phenotype
Phenotype resulting from MO1-cyp26b1
No data available
Phenotype of all Fish created by or utilizing MO1-cyp26b1
1 - 5 of 19 Show all
Citations
- Addison, M., Xu, Q., Cayuso, J., Wilkinson, D.G. (2018) Cell Identity Switching Regulated by Retinoic Acid Signaling Maintains Homogeneous Segments in the Hindbrain. Developmental Cell. 45:606-620.e3
- Liang, D., Jia, W., Li, J., Li, K., and Zhao, Q. (2012) Retinoic Acid signaling plays a restrictive role in zebrafish primitive myelopoiesis. PLoS One. 7(2):e30865
- Kinkel, M.D., Sefton, E.M., Kikuchi, Y., Mizoguchi, T., Ward, A.B., and Prince, V.E. (2009) Cyp26 enzymes function in endoderm to regulate pancreatic field size. Proceedings of the National Academy of Sciences of the United States of America. 106(19):7864-7869
- Hernandez, R.E., Putzke, A.P., Myers, J.P., Margaretha, L., and Moens, C.B. (2007) Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development. Development (Cambridge, England). 134(1):177-187
1 - 4 of 4
Show