Morpholino

MO1-smarcd3b

ID

ZDB-MRPHLNO-070409-1

Name

MO1-smarcd3b

Previous Names

MO1-smarcd3l

Target

smarcd3b (1)

Sequence

5' - TTCCCTCCGCTTCTCCTGCCTTTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-smarcd3b

Expressed Gene	Anatomy	Figures
lft1	diencephalon notochord	Fig. 4 , text only from Takeuchi et al., 2007
lft2	heart primordium	Fig. 4 , text only from Takeuchi et al., 2007
myl7	heart tube	Fig. 1 from Lou et al., 2011
nkx2.5	heart primordium	Fig. 1 from Lou et al., 2011
spaw	lateral plate mesoderm	text only from Takeuchi et al., 2007

Phenotype

Phenotype resulting from MO1-smarcd3b

Phenotype	Fish	Figures
heart inverted, abnormal	WT + MO1-smarcd3b	Fig. 4 from Takeuchi et al., 2007
heart morphology, abnormal	WT + MO1-smarcd3b	Fig. 1 from Lou et al., 2011
heart looping disrupted, abnormal	twu34Tg + MO1-smarcd3b	Fig. 1 from Lou et al., 2011 text only from Takeuchi et al., 2007

Phenotype of all Fish created by or utilizing MO1-smarcd3b

Phenotype	Fish	Conditions	Figures
heart morphology, abnormal	WT + MO1-smarcd3b	standard conditions	Fig. 1 from Lou et al., 2011
heart looping disrupted, abnormal	WT + MO1-smarcd3b	standard conditions	text only from Takeuchi et al., 2007
heart inverted, abnormal	WT + MO1-smarcd3b	standard conditions	Fig. 4 from Takeuchi et al., 2007
heart looping disrupted, abnormal	twu34Tg + MO1-smarcd3b	standard conditions	Fig. 1 from Lou et al., 2011
heart morphogenesis disrupted, abnormal	WT + MO1-gata5 + MO1-smarcd3b	standard conditions	Fig. 1 from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal	WT + MO1-gata5 + MO1-smarcd3b	standard conditions	Fig. 1 from Lou et al., 2011
heart tube bifurcated, abnormal	WT + MO1-gata5 + MO1-smarcd3b	standard conditions	Fig. 1 from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal	WT + MO1-gata5 + MO1-smarcd3b	standard conditions	Fig. 1 from Lou et al., 2011
heart morphogenesis disrupted, abnormal	WT + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011
heart morphology, abnormal	WT + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011
heart morphogenesis arrested, abnormal	WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011
heart tube bifurcated, abnormal	WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal	WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal	WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011
heart bifurcated, abnormal	twu34Tg + MO1-gata5 + MO1-smarcd3b	standard conditions	Fig. 1 from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal	twu34Tg + MO1-gata5 + MO1-smarcd3b	standard conditions	Fig. 1 from Lou et al., 2011
heart morphogenesis disrupted, abnormal	twu34Tg + MO1-gata5 + MO1-smarcd3b	standard conditions	Fig. 1 from Lou et al., 2011
heart looping disrupted, abnormal	twu34Tg + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011
pharyngeal musculature morphology, abnormal	el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. S1 from Lou et al., 2011
heart morphology, abnormal	el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. S1 from Lou et al., 2011
endocardium aplastic, abnormal	s843Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. S1 from Lou et al., 2011
heart morphogenesis disrupted, abnormal	twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal	twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011
heart bifurcated, abnormal	twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a	standard conditions	Fig. 1 from Lou et al., 2011

Citations