Morpholino
MO2-notch3
- ID
- ZDB-MRPHLNO-070328-3
- Name
- MO2-notch3
- Previous Names
- None
- Target
- Sequence
-
5' - GCTCCAGGCAATCACATTAGGATGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-notch3
No data available
Phenotype
Phenotype resulting from MO2-notch3
No data available
Phenotype of all Fish created by or utilizing MO2-notch3
1 - 5 of 5
Citations
- Okigawa, S., Mizoguchi, T., Okano, M., Tanaka, H., Isoda, M., Jiang, Y.J., Suster, M., Higashijima, S.I., Kawakami, K., Itoh, M. (2014) Different combinations of Notch ligands and receptors regulate V2 interneuron progenitor proliferation and V2a/V2b cell fate determination. Developmental Biology. 391(2):196-206
- Mizoguchi, T., Togawa, S., Kawakami, K., and Itoh, M. (2011) Neuron and sensory epithelial cell fate is sequentially determined by notch signaling in zebrafish lateral line development. The Journal of neuroscience : the official journal of the Society for Neuroscience. 31(43):15522-15530
- Tsutsumi, M., and Itoh, M. (2007) Novel transcript nort is a downstream target gene of the Notch signaling pathway in zebrafish. Gene expression patterns : GEP. 793):227-232
1 - 3 of 3
Show