Morpholino
MO2-snai1a
- ID
- ZDB-MRPHLNO-061206-4
- Name
- MO2-snai1a
- Previous Names
-
- Snail1aMO (1)
- Target
- Sequence
-
5' - GTCCACTCCAGTTACTTTCAGGGAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-snai1a
No data available
Phenotype
Phenotype resulting from MO2-snai1a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO2-snai1a
1 - 5 of 6 Show all
Citations
- Chen, Y.Y., Harris, M.P., Levesque, M.P., Nüsslein-Volhard, C., and Sonawane, M. (2012) Heterogeneity across the dorso-ventral axis in zebrafish EVL is regulated by a novel module consisting of sox, snail1a and max genes. Mechanisms of Development. 129(1-4):13-23
- Fior, R., Maxwell, A.A., Ma, T.P., Vezzaro, A., Moens, C.B., Amacher, S.L., Lewis, J., and Saúde, L. (2012) The differentiation and movement of presomitic mesoderm progenitor cells are controlled by Mesogenin 1. Development (Cambridge, England). 139(24):4656-4665
- Liu, X., Huang, S., Ma, J., Li, C., Zhang, Y., and Luo, L. (2009) NF-kappaB and Snail1a coordinate the cell cycle with gastrulation. The Journal of cell biology. 184(6):805-815
- Blanco, M.J., Barrallo-Gimeno, A., Acloque, H., Reyes, A.E., Tada, M., Allende, M.L., Mayor, R., and Nieto, M.A. (2007) Snail1a and Snail1b cooperate in the anterior migration of the axial mesendoderm in the zebrafish embryo. Development (Cambridge, England). 134(22):4073-4081
- Arnaud, E., Ferri, K.F., Thibaut, J., Haftek-Terreau, Z., Aouacheria, A., Le Guellec, D., Lorca, T., and Gillet, G. (2006) The zebrafish bcl-2 homologue Nrz controls development during somitogenesis and gastrulation via apoptosis-dependent and -independent mechanisms. Cell death and differentiation. 13(7):1128-1137
- Yamashita, S., Miyagi, C., Fukada, T., Kagara, N., Che, Y.S., and Hirano, T. (2004) Zinc transporter LIVI controls epithelial-mesenchymal transition in zebrafish gastrula organizer. Nature. 429(6989):298-302
1 - 6 of 6
Show