Morpholino
MO2-foxi1
- ID
- ZDB-MRPHLNO-061106-7
- Name
- MO2-foxi1
- Previous Names
-
- foxi1-MO (1)
- Target
- Sequence
-
5' - TAATCCGCTCTCCCTCCAGAAACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-foxi1
No data available
Phenotype
Phenotype resulting from MO2-foxi1
1 - 5 of 22 Show all
Phenotype of all Fish created by or utilizing MO2-foxi1
1 - 5 of 36 Show all
Citations
- McCarthy, N., Sidik, A., Bertrand, J.Y., Eberhart, J.K. (2016) An Fgf-Shh signaling hierarchy regulates early specification of the zebrafish skull. Developmental Biology. 415(2):261-77
- Long, L., Guo, H., Yao, D., Xiong, K., Li, Y., Liu, P., Zhu, Z., Liu, D. (2015) Regulation of transcriptionally active genes via the catalytically inactive Cas9 in C. elegans and D. rerio. Cell Research. 25:638-41
- Edlund, R.K., Ohyama, T., Kantarci, H., Riley, B.B., Groves, A.K. (2014) Foxi transcription factors promote pharyngeal arch development by regulating formation of FGF signaling centers. Developmental Biology. 390:1-13
- Yao, D., Zhao, F., Wu, Y., Wang, J., Wei, D., Zhao, J., Zhu, Z., Liu, D. (2014) Dissecting the differentiation process of the pre-placodal ectoderm in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 243(10):1338-51
- Bhat, N., Kwon, H.J., and Riley, B.B. (2013) A gene network that coordinates preplacodal competence and neural crest specification in zebrafish. Developmental Biology. 373(1):107-117
- Hans, S., Irmscher, A., and Brand, M. (2013) Zebrafish Foxi1 provides a neuronal ground state during inner ear induction preceding the Dlx3b/4b-regulated sensory lineage. Development (Cambridge, England). 140(9):1936-1945
- Padanad, M.S., Bhat, N., Guo, B., and Riley, B.B. (2012) Conditions that influence the response to Fgf during otic placode induction. Developmental Biology. 364(1):1-10
- Kwon, H.J., Bhat, N., Sweet, E.M., Cornell, R.A., and Riley, B.B. (2010) Identification of early requirements for preplacodal ectoderm and sensory organ development. PLoS Genetics. 6(9):pii: e1001133
- Hans, S., and Westerfield, M. (2007) Changes in retinoic acid signaling alter otic patterning. Development (Cambridge, England). 134(13):2449-2458
- Hans, S., Christison, J., Liu, D., and Westerfield, M. (2007) Fgf-dependent otic induction requires competence provided by Foxi1 and Dlx3b. BMC Developmental Biology. 7(1):5
1 - 10 of 14
Show