Morpholino
MO1-dachb
- ID
- ZDB-MRPHLNO-061106-3
- Name
- MO1-dachb
- Previous Names
- Target
- Sequence
-
5' - GCCATAGTGGTCATTGAACTTAAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dachb
No data available
Phenotype
Phenotype resulting from MO1-dachb
| Phenotype | Fish | Figures |
|---|---|---|
| islet shape, abnormal | AB + MO1-dachb + MO4-tp53 |
Fig. 5 
from Yang et al., 2021 |
| islet cell decreased amount, abnormal | AB + MO1-dachb + MO4-tp53 |
Fig. 5
from Yang et al., 2021 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-dachb
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| islet cell decreased amount, abnormal | AB + MO1-dachb + MO4-tp53 | standard conditions |
Fig. 5
from Yang et al., 2021 |
| islet shape, abnormal | AB + MO1-dachb + MO4-tp53 | standard conditions |
Fig. 5
from Yang et al., 2021 |
1 - 2 of 2
Citations
- Yang, L., Webb, S.E., Jin, N., Lee, H.M., Chan, T.F., Xu, G., Chan, J.C.N., Miller, A.L., Ma, R.C.W. (2021) Investigating the role of dachshund b in the development of the pancreatic islet in zebrafish. Journal of diabetes investigation. 12(5):710-727
- Bricaud, O., and Collazo, A. (2006) The transcription factor six1 inhibits neuronal and promotes hair cell fate in the developing zebrafish (Danio rerio) inner ear. The Journal of neuroscience : the official journal of the Society for Neuroscience. 26(41):10438-10451
1 - 2 of 2
Show