Morpholino
MO2-spast
- ID
- ZDB-MRPHLNO-061004-2
- Name
- MO2-spast
- Previous Names
-
- spg4exon7 (1)
- Target
- Sequence
-
5' - GATGTGAAAACAGACCTCTGGACGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-spast
No data available
Phenotype
Phenotype resulting from MO2-spast
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO2-spast
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
primary motor neuron axon morphology, abnormal | AB + MO2-spast | control |
Fig. 6
from Zhang et al., 2012 |
primary motor neuron axonogenesis process quality, abnormal | AB + MO2-spast | control |
Fig. 6
from Zhang et al., 2012 |
head morphology, abnormal | AB + MO2-spast | control |
Fig. 6
from Zhang et al., 2012 |
caudal fin morphology, abnormal | AB + MO2-spast | control |
Fig. 6
from Zhang et al., 2012 |
extension morphology, abnormal | AB + MO2-spast | control |
Fig. 6
from Zhang et al., 2012 |
1 - 5 of 14 Show all
Citations
- Zhang, C., Li, D., Ma, Y., Yan, J., Yang, B., Li, P., Yu, A., Lu, C., and Ma, X. (2012) Role of spastin and protrudin in neurite outgrowth. Journal of cellular biochemistry. 113(7):2296-2307
- Butler, R., Wood, J.D., Landers, J.A., and Cunliffe, V.T. (2010) Genetic and chemical modulation of spastin-dependent axon outgrowth in zebrafish embryos indicates a role for impaired microtubule dynamics in hereditary spastic paraplegia. Disease models & mechanisms. 3(11-12):743-751
- Wood, J.D., Landers, J.A., Bingley, M., McDermott, C.J., Thomas-McArthur, V., Gleadall, L.J., Shaw, P.J., and Cunliffe, V.T. (2006) The microtubule-severing protein Spastin is essential for axon outgrowth in the zebrafish embryo. Human molecular genetics. 15(18):2763-2771
1 - 3 of 3
Show