Morpholino
MO1-ndr2
- ID
- ZDB-MRPHLNO-060930-4
- Name
- MO1-ndr2
- Previous Names
-
- Cyclops-MO1 (1)
- Target
- Sequence
-
5' - GCGACTCCGAGCGTGTGCATGATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Contains a one base pair mismatch to minimize secondary structure (Karlen and Rebagliati (2001) Genesis 30: 126-128).
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ndr2
No data available
Phenotype
Phenotype resulting from MO1-ndr2
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-ndr2
1 - 5 of 24 Show all
Citations
- Kurup, A.J., Bailet, F., Fürthauer, M. (2024) Myosin1G promotes Nodal signaling to control zebrafish left-right asymmetry. Nature communications. 15:65476547
- Schauer, A., Pinheiro, D., Hauschild, R., Heisenberg, C.P. (2020) Zebrafish embryonic explants undergo genetically encoded self-assembly. eLIFE. 9:
- Liu, Z., Woo, S., Weiner, O.D. (2018) Nodal signaling has dual roles in fate specification and directed migration during germ layer segregation. Development (Cambridge, England). 145(17):
- Pelliccia, J.L., Jindal, G.A., Burdine, R.D. (2017) Gdf3 is required for robust Nodal signaling during germ layer formation and left-right patterning. eLIFE. 6
- Dubrulle, J., Jordan, B.M., Akhmetova, L., Farrell, J.A., Kim, S.H., Solnica-Krezel, L., Schier, A.F. (2015) Response to Nodal morphogen gradient is determined by the kinetics of target gene induction. eLIFE. 4
- Chen, Y.Y., Harris, M.P., Levesque, M.P., Nüsslein-Volhard, C., and Sonawane, M. (2012) Heterogeneity across the dorso-ventral axis in zebrafish EVL is regulated by a novel module consisting of sox, snail1a and max genes. Mechanisms of Development. 129(1-4):13-23
- Hong, S.K., Jang, M.K., Brown, J.L., McBride, A.A., and Feldman, B. (2011) Embryonic mesoderm and endoderm induction requires the actions of non-embryonic Nodal-related ligands and Mxtx2. Development (Cambridge, England). 138(4):787-795
- Slagle, C.E., Aoki, T., and Burdine, R.D. (2011) Nodal-Dependent Mesendoderm Specification Requires the Combinatorial Activities of FoxH1 and Eomesodermin. PLoS Genetics. 7(5):e1002072
- Varga, M., Maegawa, S., and Weinberg, E.S. (2011) Correct anteroposterior patterning of the zebrafish neurectoderm in the absence of the early dorsal organizer. BMC Developmental Biology. 11(1):26
- Mangos, S., Lam, P.Y., Zhao, A., Liu, Y., Mudumana, S., Vasilyev, A., Liu, A., and Drummond, I.A. (2010) The ADPKD genes pkd1a/b and pkd2 regulate extracellular matrix formation. Disease models & mechanisms. 3(5-6):354-365
1 - 10 of 17
Show