Morpholino
MO2-acvr1l
- ID
- ZDB-MRPHLNO-060920-2
- Name
- MO2-acvr1l
- Previous Names
- Target
- Sequence
-
5' - GATTCATGTTTGTGTTCAATTTCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-acvr1l
No data available
Phenotype
Phenotype resulting from MO2-acvr1l
Phenotype | Fish | Figures |
---|---|---|
post-vent region truncated, abnormal | WT + MO2-acvr1l |
Fig. 2 ![]() |
whole organism wholly dorsalized, abnormal | WT + MO2-acvr1l |
Fig. 5
from Umasankar et al., 2012 Fig. 2 ![]() |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-acvr1l
1 - 5 of 16 Show all
Citations
- Allen, R.S., Jones, W.D., Hale, M., Warder, B.N., Shore, E.M., Mullins, M.C. (2023) Reduced GS domain serine/threonine requirements of Fibrodysplasia Ossificans Progressiva mutant type I BMP receptor ACVR1 in the zebrafish. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research. 38(9):1364-1385
- Tajer, B., Dutko, J.A., Little, S.C., Mullins, M.C. (2021) BMP heterodimers signal via distinct type I receptor class functions. Proceedings of the National Academy of Sciences of the United States of America. 118(15):
- Allen, R.S., Tajer, B., Shore, E.M., Mullins, M.C. (2020) Fibrodysplasia ossificans progressiva mutant ACVR1 signals by multiple modalities in the developing zebrafish. eLIFE. 9:
- Neal, A., Nornes, S., Payne, S., Wallace, M.D., Fritzsche, M., Louphrasitthiphol, P., Wilkinson, R.N., Chouliaras, K.M., Liu, K., Plant, K., Sholapurkar, R., Ratnayaka, I., Herzog, W., Bond, G., Chico, T., Bou-Gharios, G., De Val, S. (2019) Venous identity requires BMP signalling through ALK3. Nature communications. 10:453
- Kim, J.D., Kim, J. (2014) Alk3/Alk3b and Smad5 Mediate BMP Signaling during Lymphatic Development in Zebrafish. Molecules and cells. 37:270-4
- Umasankar, P.K., Sanker, S., Thieman, J.R., Chakraborty, S., Wendland, B., Tsang, M., and Traub, L.M. (2012) Distinct and separable activities of the endocytic clathrin-coat components Fcho1/2 and AP-2 in developmental patterning. Nature cell biology. 14(5):488-501
- Little, S.C., and Mullins, M.C. (2009) Bone morphogenetic protein heterodimers assemble heteromeric type I receptor complexes to pattern the dorsoventral axis. Nature cell biology. 11(5):637-643
- von der Hardt, S., Bakkers, J., Inbal, A., Carvalho, L., Solnica-Krezel, L., Heisenberg, C.P., and Hammerschmidt, M. (2007) The Bmp Gradient of the Zebrafish Gastrula Guides Migrating Lateral Cells by Regulating Cell-Cell Adhesion. Current biology : CB. 17(6):475-487
- Bauer, H., Lele, Z., Rauch, G.J., Geisler, R., and Hammerschmidt, M. (2001) The type I serine/threonine kinase receptor Alk8/Lost-a-fin is required for Bmp2b/7 signal transduction during dorsoventral patterning of the zebrafish embryo. Development (Cambridge, England). 128(6):849-858
1 - 9 of 9
Show