Morpholino
MO2-ptch1
- ID
- ZDB-MRPHLNO-060828-5
- Name
- MO2-ptch1
- Previous Names
-
- MO2-ptc2
- Ptc2 splice MO (1)
- Target
- Sequence
-
5' - CTAGCAAATAAGCCATACCTGTTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ptch1
No data available
Phenotype
Phenotype resulting from MO2-ptch1
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-ptch1
1 - 4 of 4
Citations
- Chassaing, N., Davis, E.E., McKnight, K.L., Niederriter, A.R., Causse, A., David, V., Desmaison, A., Lamarre, S., Vincent-Delorme, C., Pasquier, L., Coubes, C., Lacombe, D., Rossi, M., Dufier, J.L., Dollfus, H., Kaplan, J., Katsanis, N., Etchevers, H.C., Faguer, S., Calvas, P. (2016) Targeted resequencing identifies PTCH1 as a major contributor to ocular developmental anomalies and extends the SOX2 regulatory network. Genome research. 26(4):474-85
- Koudijs, M.J., den Broeder, M.J., Keijser, A., Wienholds, E., Houwing, S., van Rooijen, E.M., Geisler, R., and van Eeden, F.J. (2005) The Zebrafish Mutants dre, uki, and lep Encode Negative Regulators of the Hedgehog Signaling Pathway. PLoS Genetics. 1(2):e19
1 - 2 of 2
Show