Morpholino
MO3-isl1a
- ID
- ZDB-MRPHLNO-060728-2
- Name
- MO3-isl1a
- Previous Names
-
- islet1E3 (1)
- MO3-isl1
- Target
- Sequence
-
5' - GAATGCAATGCCTACCTGCCATTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-isl1a
No data available
Phenotype
Phenotype resulting from MO3-isl1a
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO3-isl1a
1 - 5 of 26 Show all
Citations
- Moreno, R.L., Ribera, A.B. (2014) Spinal neurons require Islet1 for subtype-specific differentiation of electrical excitability. Neural Development. 9:19
- Seredick, S., Hutchinson, S.A., Van Ryswyk, L., Talbot, J.C., Eisen, J.S. (2014) Lhx3 and Lhx4 suppress Kolmer-Agduhr interneuron characteristics within zebrafish axial motoneurons. Development (Cambridge, England). 141(20):3900-9
- Wang, L., Mongera, A., Bonanomi, D., Cyganek, L., Pfaff, S.L., Nüsslein-Volhard, C., Marquardt, T. (2014) A conserved axon type hierarchy governing peripheral nerve assembly. Development (Cambridge, England). 141:1875-83
- Seredick, S., Van Ryswyk, L., Hutchinson, S.A., and Eisen, J.S. (2012) Zebrafish Mnx proteins specify one motoneuron subtype and suppress acquisition of interneuron characteristics. Neural Development. 7(1):35
- Witzel, H.R., Jungblut, B., Choe, C.P., Crump, J.G., Braun, T., and Dobreva, G. (2012) The LIM Protein Ajuba Restricts the Second Heart Field Progenitor Pool by Regulating Isl1 Activity. Developmental Cell. 23(1):58-70
- Lim, A.H., Suli, A., Yaniv, K., Weinstein, B., Li, D.Y., and Chien, C.B. (2011) Motoneurons are essential for vascular pathfinding. Development (Cambridge, England). 138(17):3847-3857
- de Pater, E., Clijsters, L., Marques, S.R., Lin, Y.F., Garavito-Aguilar, Z.V., Yelon, D., and Bakkers, J. (2009) Distinct phases of cardiomyocyte differentiation regulate growth of the zebrafish heart. Development (Cambridge, England). 136(10):1633-1641
- Hutchinson, S.A., and Eisen, J.S. (2006) Islet1 and Islet2 have equivalent abilities to promote motoneuron formation and to specify motoneuron subtype identity. Development (Cambridge, England). 133(11):2137-2147
1 - 8 of 8
Show