Morpholino
MO1-dvl3a
- ID
- ZDB-MRPHLNO-060724-2
- Name
- MO1-dvl3a
- Previous Names
-
- dsh 3 MO (1)
- MO1-dvl3
- Target
- Sequence
-
5' - GGTAGATAACTTTAGTCTCCCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dvl3a
No data available
Phenotype
Phenotype resulting from MO1-dvl3a
No data available
Phenotype of all Fish created by or utilizing MO1-dvl3a
1 - 5 of 25 Show all
Citations
- Cheng, X.N., Shao, M., Li, J.T., Wang, Y.F., Qi, J., Xu, Z.G., Shi, D.L. (2017) Leucine repeat adaptor protein 1 interacts with Dishevelled to regulate gastrulation cell movements in zebrafish. Nature communications. 8:1353
- Shimizu, N., Ishitani, S., Sato, A., Shibuya, H., Ishitani, T. (2014) Hipk2 and PP1c Cooperate to Maintain Dvl Protein Levels Required for Wnt Signal Transduction. Cell Reports. 8(5):1391-404
- Mahuzier, A., Gaudé, H.M., Grampa, V., Anselme, I., Silbermann, F., Leroux-Berger, M., Delacour, D., Ezan, J., Montcouquiol, M., Saunier, S., Schneider-Maunoury, S., and Vesque, C. (2012) Dishevelled stabilization by the ciliopathy protein Rpgrip1l is essential for planar cell polarity. The Journal of cell biology. 198(5):927-940
- Yang, Y., and Thorpe, C. (2011) BMP and non-canonical Wnt signaling are required for inhibition of secondary tail formation in zebrafish. Development (Cambridge, England). 138(12):2601-2611
- Segalen, M., Johnston, C.A., Martin, C.A., Dumortier, J.G., Prehoda, K.E., David, N.B., Doe, C.Q., and Bellaiche, Y. (2010) The Fz-Dsh Planar Cell Polarity Pathway Induces Oriented Cell Division via Mud/NuMA in Drosophila and Zebrafish. Developmental Cell. 19(5):740-752
- Angers, S., Thorpe, C.J., Biechele, T.L., Goldenberg, S.J., Zheng, N., Maccoss, M.J., and Moon, R.T. (2006) The KLHL12-Cullin-3 ubiquitin ligase negatively regulates the Wnt-beta-catenin pathway by targeting Dishevelled for degradation. Nature cell biology. 8(4):348-357
1 - 6 of 6
Show