Morpholino
MO5-dlc
- ID
- ZDB-MRPHLNO-060712-1
- Name
- MO5-dlc
- Previous Names
-
- dlCatg (1)
- Target
- Sequence
-
5' - GCACGTTAATAAAACACGAGCCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-dlc
No data available
Phenotype
Phenotype resulting from MO5-dlc
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO5-dlc
1 - 3 of 3
Citations
- Geudens, I., Herpers, R., Hermans, K., Segura, I., Ruiz de Almodovar, C., Bussmann, J., De Smet, F., Vandevelde, W., Hogan, B.M., Siekmann, A., Claes, F., Moore, J.C., Pistocchi, A.S., Loges, S., Mazzone, M., Mariggi, G., Bruyere, F., Cotelli, F., Kerjaschki, D., Noel, A., Foidart, J.M., Gerhardt, H., Ny, A., Langenberg, T., Lawson, N.D., Duckers, H.J., Schulte-Merker, S., Carmeliet, P., and Dewerchin, M. (2010) Role of delta-like-4/Notch in the formation and wiring of the lymphatic network in zebrafish. Arterioscler. Thromb. Vasc. Biol.. 30(9):1695-1702
- Shaw, K.M., Castranova, D.A., Pham, V.N., Kamei, M., Kidd, K.R., Lo, B.D., Torres-Vazquez, J., Ruby, A., and Weinstein, B.M. (2006) fused-somites-like mutants exhibit defects in trunk vessel patterning. Developmental Dynamics : an official publication of the American Association of Anatomists. 235(7):1753-1760
1 - 2 of 2
Show