Morpholino
MO2-nrp2a
- ID
- ZDB-MRPHLNO-060605-2
- Name
- MO2-nrp2a
- Previous Names
-
- 2AMO (1)
- Target
- Sequence
-
5' - CTTGGTGTGATATCCAGAAATCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nrp2a
No data available
Phenotype
Phenotype resulting from MO2-nrp2a
No data available
Phenotype of all Fish created by or utilizing MO2-nrp2a
1 - 3 of 3
Citations
- Terriente, J., Gerety, S.S., Watanabe-Asaka, T., Gonzalez-Quevedo, R., and Wilkinson, D.G. (2012) Signalling from hindbrain boundaries regulates neuronal clustering that patterns neurogenesis. Development (Cambridge, England). 139(16):2978-2987
- Tanaka, H., Maeda, R., Shoji, W., Wada, H., Masai, I., Shiraki, T., Kobayashi, M., Nakayama, R., and Okamoto, H. (2007) Novel mutations affecting axon guidance in zebrafish and a role for plexin signalling in the guidance of trigeminal and facial nerve axons. Development (Cambridge, England). 134(18):3259-3269
- Wolman, M.A., Liu, Y., Tawarayama, H., Shoji, W., and Halloran, M.C. (2004) Repulsion and attraction of axons by Semaphorin3D are mediated by different neuropilins in vivo. The Journal of neuroscience : the official journal of the Society for Neuroscience. 24(39):8428-8435
1 - 3 of 3
Show