Morpholino
MO2-tbx5a
- ID
- ZDB-MRPHLNO-060328-3
- Name
- MO2-tbx5a
- Previous Names
-
- MO2-tbx5 (1)
- Target
- Sequence
-
5' - CCTGTACGATGTCTACCGTGAGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tbx5a
No data available
Phenotype
Phenotype resulting from MO2-tbx5a
1 - 5 of 24 Show all
Phenotype of all Fish created by or utilizing MO2-tbx5a
1 - 5 of 55 Show all
Citations
- Boyle-Anderson, E.A.T, Mao, Q., Ho, R.K. (2021) Tbx5a and Tbx5b paralogues act in combination to control separate vectors of migration in the fin field of zebrafish. Developmental Biology. 481:201-214
- Mao, L.M.F., Boyle Anderson, E.A.T., Ho, R.K. (2021) Anterior lateral plate mesoderm gives rise to multiple tissues and requires tbx5a function in left-right asymmetry, migration dynamics, and cell specification of late-addition cardiac cells. Developmental Biology. 472:52-66
- Boyle Anderson, E.A.T., Ho, R.K. (2018) A transcriptomics analysis of the Tbx5 paralogues in zebrafish. PLoS One. 13:e0208766
- Felker, A., Prummel, K.D., Merks, A.M., Mickoleit, M., Brombacher, E.C., Huisken, J., Panáková, D., Mosimann, C. (2018) Continuous addition of progenitors forms the cardiac ventricle in zebrafish. Nature communications. 9:2001
- Steimle, J.D., Rankin, S.A., Slagle, C.E., Bekeny, J., Rydeen, A.B., Chan, S.S., Kweon, J., Yang, X.H., Ikegami, K., Nadadur, R.D., Rowton, M., Hoffmann, A.D., Lazarevic, S., Thomas, W., Boyle Anderson, E.A.T., Horb, M.E., Luna-Zurita, L., Ho, R.K., Kyba, M., Jensen, B., Zorn, A.M., Conlon, F.L., Moskowitz, I.P. (2018) Evolutionarily conserved Tbx5-Wnt2/2b pathway orchestrates cardiopulmonary development.. Proceedings of the National Academy of Sciences of the United States of America. 115(45):E10615-E10624
- Mao, Q., Stinnett, H.K., Ho, R.K. (2015) Asymmetric cell convergence-driven fin bud initiation and pre-pattern requires Tbx5a control of a mesenchymal Fgf signal. Development (Cambridge, England). 142(24):4329-39
- Mosimann, C., Panáková, D., Werdich, A.A., Musso, G., Burger, A., Lawson, K.L., Carr, L.A., Nevis, K.R., Sabeh, M.K., Zhou, Y., Davidson, A.J., DiBiase, A., Burns, C.E., Burns, C.G., MacRae, C.A., Zon, L.I. (2015) Chamber identity programs drive early functional partitioning of the heart. Nature communications. 6:8146
- Musso, G., Mosimann, C., Panáková, D., Burger, A., Zhou, Y., Zon, L.I., MacRae, C.A. (2015) Generating and evaluating a ranked candidate gene list for potential vertebrate heart field regulators. Genomics Data. 6:199-201
- Perni, S., Marsden, K.C., Escobar, M., Hollingworth, S., Baylor, S.M., Franzini-Armstrong, C. (2015) Structural and functional properties of ryanodine receptor type 3 in zebrafish tail muscle. The Journal of general physiology. 145(3):173-84
- Rothschild, S.C., Easley, C.A. 4th, Francescatto, L., Lister, J.A., Garrity, D.M., and Tombes, R.M. (2009) Tbx5-mediated expression of Ca(2+)/calmodulin-dependent protein kinase II is necessary for zebrafish cardiac and pectoral fin morphogenesis. Developmental Biology. 330(1):175-184
1 - 10 of 11
Show