Morpholino
MO1-lef1
- ID
- ZDB-MRPHLNO-060214-5
- Name
- MO1-lef1
- Previous Names
- None
- Target
- Sequence
-
5' - CTCCTCCACCTGACAACTGCGGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lef1
No data available
Phenotype
Phenotype resulting from MO1-lef1
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO1-lef1
1 - 5 of 20 Show all
Citations
- Hübner, K., Grassme, K.S., Rao, J., Wenke, N.K., Zimmer, C.L., Korte, L., Mu Ller, K., Sumanas, S., Greber, B., Herzog, W. (2017) Wnt Signaling Positively Regulates Endothelial Cell Fate Specification in the Fli1a-Positive Progenitor Population via Lef1. Developmental Biology. 430(1):142-155
- Nicenboim, J., Malkinson, G., Lupo, T., Asaf, L., Sela, Y., Mayseless, O., Gibbs-Bar, L., Senderovich, N., Hashimshony, T., Shin, M., Jerafi-Vider, A., Avraham-Davidi, I., Krupalnik, V., Hofi, R., Almog, G., Astin, J.W., Golani, O., Ben-Dor, S., Crosier, P.S., Herzog, W., Lawson, N.D., Hanna, J.H., Yanai, I., Yaniv, K. (2015) Lymphatic vessels arise from specialized angioblasts within a venous niche. Nature. 522(7554):56-61
- Ota, S., Ishitani, S., Shimizu, N., Matsumoto, K., Itoh, M., and Ishitani, T. (2012) NLK positively regulates Wnt/beta-catenin signalling by phosphorylating LEF1 in neural progenitor cells. The EMBO journal. 31(8):1904-1915
- Shimizu, N., Kawakami, K., and Ishitani, T. (2012) Visualization and exploration of Tcf/Lef function using a highly responsive Wnt/beta-catenin signaling-reporter transgenic zebrafish. Developmental Biology. 370(1):71-85
- Gamba, L., Cubedo, N., Lutfalla, G., Ghysen, A., and Dambly-Chaudiere, C. (2010) Lef1 controls patterning and proliferation in the posterior lateral line system of zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(12):3163-3171
- Paridaen, J.T., Danesin, C., Elas, A.T., van de Water, S., Houart, C., and Zivkovic, D. (2009) Apc1 is required for maintenance of local brain organizers and dorsal midbrain survival. Developmental Biology. 331(2):101-112
- Tee, J.M., van Rooijen, C., Boonen, R., and Zivkovic, D. (2009) Regulation of slow and fast muscle myofibrillogenesis by Wnt/beta-catenin and myostatin signaling. PLoS One. 4(6):e5880
- Thatcher, E.J., Paydar, I., Anderson, K.K., and Patton, J.G. (2008) Regulation of zebrafish fin regeneration by microRNAs. Proceedings of the National Academy of Sciences of the United States of America. 105(47):18384-18389
- Ishitani, T., Matsumoto, K., Chitnis, A.B., and Itoh, M. (2005) Nrarp functions to modulate neural-crest-cell differentiation by regulating LEF1 protein stability. Nature cell biology. 7(11):1106-1112
- Thorpe, C.J., and Moon, R.T. (2004) nemo-like kinase is an essential co-activator of Wnt signaling during early zebrafish development. Development (Cambridge, England). 131(12):2899-2909
1 - 10 of 11
Show