Morpholino

MO1-lef1

ID
ZDB-MRPHLNO-060214-5
Name
MO1-lef1
Previous Names
None
Target
Sequence
5' - CTCCTCCACCTGACAACTGCGGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lef1
Expressed Gene Anatomy Figures
crestin Fig. 2,  Fig. 3,  Fig. S2 from Ishitani et al., 2005
foxd3 Fig. 2 from Ishitani et al., 2005
her4.1 Fig. S3 from Ishitani et al., 2005
mitfa Fig. 3 from Ishitani et al., 2005
mstnb Fig. 7 with image from Tee et al., 2009
Phenotype
Phenotype resulting from MO1-lef1
Phenotype Fish Figures
cartilage morphogenesis disrupted, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
caudal fin morphology, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
cranial cartilage morphology, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
dorsal root ganglion decreased amount, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
melanocyte decreased amount, abnormal WT + MO1-lef1 Fig. 3 from Ishitani et al., 2005
neural crest cell development disrupted, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
neural crest cell migration disrupted, abnormal WT + MO1-lef1 Fig. 2 from Ishitani et al., 2005
paraxial mesoderm decreased size, abnormal WT + MO1-lef1 Fig. 2 with image from Dorsky et al., 2002
pigment cell differentiation disrupted, abnormal WT + MO1-lef1 Fig. 3 from Ishitani et al., 2005
pigmentation disrupted, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
post-anal tail morphogenesis disrupted, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
post-vent region decreased length, abnormal WT + MO1-lef1 Fig. 2 with image from Dorsky et al., 2002
post-vent region truncated, abnormal WT + MO1-lef1 Fig. 2 with image from Dorsky et al., 2002
somite decreased amount, abnormal WT + MO1-lef1 Fig. 7 with image from Tee et al., 2009
trunk neural crest cell decreased amount, abnormal w25Tg + MO1-lef1 Fig. 3 from Ishitani et al., 2005
trunk neural crest cell positional polarity, abnormal WT + MO1-lef1 Fig. 2 from Ishitani et al., 2005
whole organism decreased pigmentation, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
whole organism decreased size, abnormal WT + MO1-lef1 Fig. 1 from Ishitani et al., 2005
Phenotype of all Fish created by or utilizing MO1-lef1
Phenotype Fish Conditions Figures
melanocyte decreased amount, abnormal WT + MO1-lef1 standard conditions Fig. 3 from Ishitani et al., 2005
caudal fin morphology, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
cartilage morphogenesis disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
neural crest cell development disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
post-vent region decreased length, abnormal WT + MO1-lef1 standard conditions Fig. 2 with image from Dorsky et al., 2002
post-vent region truncated, abnormal WT + MO1-lef1 standard conditions Fig. 2 with image from Dorsky et al., 2002
paraxial mesoderm decreased size, abnormal WT + MO1-lef1 standard conditions Fig. 2 with image from Dorsky et al., 2002
somite decreased amount, abnormal WT + MO1-lef1 standard conditions Fig. 7 with image from Tee et al., 2009
whole organism decreased pigmentation, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
cranial cartilage morphology, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
trunk neural crest cell positional polarity, abnormal WT + MO1-lef1 standard conditions Fig. 2 from Ishitani et al., 2005
whole organism decreased size, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
pigmentation disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
post-anal tail morphogenesis disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
dorsal root ganglion decreased amount, abnormal WT + MO1-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
pigment cell differentiation disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 3 from Ishitani et al., 2005
neural crest cell migration disrupted, abnormal WT + MO1-lef1 standard conditions Fig. 2 from Ishitani et al., 2005
trunk neural crest cell decreased amount, abnormal w25Tg + MO1-lef1 standard conditions Fig. 3 from Ishitani et al., 2005
somite decreased amount, abnormal apczf134/zf134; axin1tm13/tm13 + MO1-lef1 standard conditions Fig. 7 with image from Tee et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.