Morpholino

MO1-lama4

ID
ZDB-MRPHLNO-060119-6
Name
MO1-lama4
Previous Names
  • lama4 MO1 (1)
Target
Sequence
5' - GCCATGATTCCCCCTGCAACAACTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lama4
No data available
Phenotype
Phenotype resulting from MO1-lama4
Phenotype of all Fish created by or utilizing MO1-lama4
Phenotype Fish Conditions Figures
myotome morphology, abnormal WT + MO1-lama4 standard conditions Fig. 4 from Sztal et al., 2012
brain morphology, abnormal WT + MO1-lama4 standard conditions Fig. 6 with image from Pollard et al., 2006
heart decreased functionality, abnormal WT + MO1-lama4 standard conditions text only from Knöll et al., 2007
blood vasculature broken, abnormal WT + MO1-lama4 standard conditions text only from Knöll et al., 2007
somite morphology, abnormal WT + MO1-lama4 standard conditions Fig. 4 with image from Postel et al., 2008
somite U-shaped, abnormal WT + MO1-lama4 standard conditions Fig. 3 from Sztal et al., 2012
somite border shape, abnormal WT + MO1-lama4 standard conditions Fig. 4 with image from Postel et al., 2008
brain vasculature broken, abnormal ilkhu801/+ + MO1-lama4 standard conditions Fig. 3 from Knöll et al., 2007
pericardium edematous, abnormal ilkhu801/+ + MO1-lama4 standard conditions Fig. 3 from Knöll et al., 2007
brain morphology, abnormal lama1m190/m190 + MO1-lama4 (AB) standard conditions Fig. 6 with image from Pollard et al., 2006
notochord morphology, abnormal lama1m190/m190 + MO1-lama4 (AB) standard conditions Fig. 6 with image from Pollard et al., 2006
angiogenesis delayed, abnormal lama1m190/m190 + MO1-lama4 (AB) standard conditions Fig. 7 with image from Pollard et al., 2006
intersegmental vessel aplastic, abnormal lama1m190/m190 + MO1-lama4 (AB) standard conditions Fig. 7 with image from Pollard et al., 2006
myotome refractivity, abnormal lama2teg15a/teg15a + MO1-lama4 standard conditions Fig. 4 from Sztal et al., 2012
myotome morphology, abnormal lama2teg15a/teg15a + MO1-lama4 standard conditions Fig. 4 from Sztal et al., 2012
apoptotic process increased occurrence, abnormal lama2teg15a/teg15a + MO1-lama4 standard conditions Fig. 4 from Sztal et al., 2012
skeletal muscle cell apoptotic, abnormal lama2teg15a/teg15a + MO1-lama4 standard conditions Fig. 4 from Sztal et al., 2012
slow muscle cell detached from myoseptum, abnormal lama2teg15a/teg15a + MO1-lama4 standard conditions Fig. 3Fig. 4 from Sztal et al., 2012
somite U-shaped, abnormal lama2teg15a/teg15a + MO1-lama4 standard conditions Fig. 3 from Sztal et al., 2012
intersegmental vessel decreased length, abnormal WT + MO1-lama1 + MO1-lama4 standard conditions Fig. 8 with image from Pollard et al., 2006
angiogenesis disrupted, abnormal WT + MO1-lama1 + MO1-lama4 standard conditions Fig. 8 with image from Pollard et al., 2006
Citations