Morpholino
MO1-mespba
- ID
- ZDB-MRPHLNO-060113-7
- Name
- MO1-mespba
- Previous Names
-
- MO1-mespb
- Target
- Sequence
-
5' - TCGGTTCTTGCTTGAGGTTTGCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mespba
No data available
Phenotype
Phenotype resulting from MO1-mespba
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-mespba
1 - 5 of 15 Show all
Citations
- Deshwar, A.R., Onderisin, J.C., Aleksandrova, A., Yuan, X., Burrows, J.T., Scott, I.C. (2016) Mespaa can potently induce cardiac fates in zebrafish. Developmental Biology. 418(1):17-27
- Windner, S.E., Doris, R.A., Ferguson, C.M., Nelson, A.C., Valentin, G., Tan, H., Oates, A.C., Wardle, F.C., Devoto, S.H. (2015) Tbx6, Mesp-b and Ripply1 regulate the onset of skeletal myogenesis in zebrafish. Development (Cambridge, England). 142(6):1159-68
- Akiyama, R., Masuda, M., Tsuge, S., Bessho, Y., and Matsui, T. (2014) An anterior limit of FGF/Erk signal activity marks the earliest future somite boundary in zebrafish. Development (Cambridge, England). 141(5):1104-1109
- Lee, H.C., Tseng, W.A., Lo, F.Y., Liu, T.M., and Tsai, H.J. (2009) FoxD5 mediates anterior-posterior polarity through upstream modulator Fgf signaling during zebrafish somitogenesis. Developmental Biology. 336(2):232-245
- Kawamura, A., Koshida, S., Hijikata, H., Ohbayashi, A., Kondoh, H., and Takada, S. (2005) Groucho-associated transcriptional repressor ripply1 is required for proper transition from the presomitic mesoderm to somites. Developmental Cell. 9(6):735-744
1 - 5 of 5
Show