Morpholino
MO1-ripply1
- ID
- ZDB-MRPHLNO-060113-5
- Name
- MO1-ripply1
- Previous Names
- None
- Target
- Sequence
-
5' - CATCGTCACTGTGTTTTTCGTTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ripply1
No data available
Phenotype
Phenotype resulting from MO1-ripply1
1 - 5 of 20 Show all
Phenotype of all Fish created by or utilizing MO1-ripply1
1 - 5 of 21 Show all
Citations
- Yabe, T., Uriu, K., Takada, S. (2023) Ripply suppresses Tbx6 to induce dynamic-to-static conversion in somite segmentation. Nature communications. 14:21152115
- Yin, J., Lee, R., Ono, Y., Ingham, P.W., Saunders, T.E. (2018) Spatiotemporal Coordination of FGF and Shh Signaling Underlies the Specification of Myoblasts in the Zebrafish Embryo. Developmental Cell. 46:735-750.e4
- Windner, S.E., Doris, R.A., Ferguson, C.M., Nelson, A.C., Valentin, G., Tan, H., Oates, A.C., Wardle, F.C., Devoto, S.H. (2015) Tbx6, Mesp-b and Ripply1 regulate the onset of skeletal myogenesis in zebrafish. Development (Cambridge, England). 142(6):1159-68
- Retnoaji, B., Akiyama, R., Matta, T., Bessho, Y., and Matsui, T. (2014) Retinoic acid controls proper head-to-trunk linkage in zebrafish by regulating an anteroposterior somitogenetic rate difference. Development (Cambridge, England). 141(1):158-165
- Wanglar, C., Takahashi, J., Yabe, T., Takada, S. (2014) Tbx Protein Level Critical for Clock-Mediated Somite Positioning Is Regulated through Interaction between Tbx and Ripply. PLoS One. 9:e107928
- Kawamura, A., Koshida, S., and Takada, S. (2008) Activator-to-repressor conversion of T-box transcription factors by the Ripply family of Groucho/TLE-associated mediators. Molecular and cellular biology. 28(10):3236-3244
- Moreno, T.A., Jappelli, R., Izpisúa Belmonte, J.C., and Kintner, C. (2008) Retinoic acid regulation of the Mesp-Ripply feedback loop during vertebrate segmental patterning. Developmental Biology. 315(2):317-330
- Kawamura, A., Koshida, S., Hijikata, H., Ohbayashi, A., Kondoh, H., and Takada, S. (2005) Groucho-associated transcriptional repressor ripply1 is required for proper transition from the presomitic mesoderm to somites. Developmental Cell. 9(6):735-744
1 - 8 of 8
Show