Morpholino

MO1-ripply1

ID
ZDB-MRPHLNO-060113-5
Name
MO1-ripply1
Previous Names
None
Target
Sequence
5' - CATCGTCACTGTGTTTTTCGTTTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ripply1
No data available
Phenotype
Phenotype resulting from MO1-ripply1
Phenotype Fish Figures
dermomyotome increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 5 with image from Windner et al., 2015
fast muscle cell skeletal muscle tissue development decreased occurrence, abnormal i233Tg + MO1-ripply1 Fig. 7 with image from Yin et al., 2018
paraxial mesoderm tbx6 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 4 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 4 with image from Windner et al., 2015
segment polarity determination disrupted, abnormal TL + MO1-ripply1 Fig. 4 from Kawamura et al., 2005
segmental plate mespba expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 4 with image from Windner et al., 2015
segmental plate mespbb expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 4 with image from Windner et al., 2015
skeletal muscle satellite cell mislocalised, abnormal i233Tg + MO1-ripply1 Fig. 7 with image from Yin et al., 2018
slow muscle cell mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 5 with image from Windner et al., 2015
slow muscle cell muscle cell migration decreased occurrence, abnormal i106Tg + MO1-ripply1 Fig. 7 with image from Yin et al., 2018
slow muscle myoblast ab-mf20 labeling increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 4 with image from Windner et al., 2015
somite pax3a expression decreased amount, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 5 with image from Windner et al., 2015
somite meox1 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 5 with image from Windner et al., 2015
somite border absent, abnormal TL + MO1-ripply1 Fig. 3 from Kawamura et al., 2005
somitogenesis disrupted, abnormal TL + MO1-ripply1 Fig. 3,  Fig. 4 from Kawamura et al., 2005
trunk ab-pax7 labeling increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 5 with image from Windner et al., 2015
trunk pax7a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 5 with image from Windner et al., 2015
trunk pax3a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 5 with image from Windner et al., 2015
trunk posterior region tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 5 with image from Windner et al., 2015
trunk posterior region tbx6 expression mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 Fig. 5 with image from Windner et al., 2015
Phenotype of all Fish created by or utilizing MO1-ripply1
Phenotype Fish Conditions Figures
segment polarity determination disrupted, abnormal TL + MO1-ripply1 standard conditions Fig. 4 from Kawamura et al., 2005
somite border absent, abnormal TL + MO1-ripply1 standard conditions Fig. 3 from Kawamura et al., 2005
somitogenesis disrupted, abnormal TL + MO1-ripply1 standard conditions Fig. 3,  Fig. 4 from Kawamura et al., 2005
trunk posterior region tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk posterior region tbx6 expression mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
segmental plate mespba expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
dermomyotome increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
somite meox1 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
slow muscle cell mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
somite pax3a expression decreased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
segmental plate mespbb expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
trunk pax7a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk ab-pax7 labeling increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk pax3a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
slow muscle myoblast ab-mf20 labeling increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
fast muscle cell skeletal muscle tissue development decreased occurrence, abnormal i106Tg + MO1-ripply1 control Fig. 7 with image from Yin et al., 2018
slow muscle cell muscle cell migration decreased occurrence, abnormal i106Tg + MO1-ripply1 control Fig. 7 with image from Yin et al., 2018
fast muscle cell skeletal muscle tissue development decreased occurrence, abnormal i233Tg + MO1-ripply1 control Fig. 7 with image from Yin et al., 2018
skeletal muscle satellite cell mislocalised, abnormal i233Tg + MO1-ripply1 control Fig. 7 with image from Yin et al., 2018
Citations