Morpholino
MO1-gna13b
- ID
- ZDB-MRPHLNO-060113-1
- Name
- MO1-gna13b
- Previous Names
-
- gna13b-MO1 (1)
- Target
- Sequence
-
5' - AGGAAATACGCCATCTTTGTGCAAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gna13b
No data available
Phenotype
Phenotype resulting from MO1-gna13b
No data available
Phenotype of all Fish created by or utilizing MO1-gna13b
1 - 5 of 59 Show all
Citations
- Hu, B., Pinzour, J., Patel, A., Rooney, F., Zerwic, A., Gao, Y., Nguyen, N.T., Xie, H., Ye, D., Lin, F. (2024) Gα13 controls pharyngeal endoderm convergence by regulating E-cadherin expression and RhoA activation. Development (Cambridge, England). 151(19):
- Mahabaleshwar, H., Asharani, P.V., Loo, T.Y., Koh, S.Y., Pitman, M.R., Kwok, S., Ma, J., Hu, B., Lin, F., Li Lok, X., Pitson, S.M., Saunders, T.E., Carney, T.J. (2022) Slit-Robo signalling establishes a Sphingosine-1-phosphate gradient to polarise fin mesenchyme. EMBO reports. 23(8):e54464
- Lei, D., Zhang, X., Rouf, M.A., Mahendra, Y., Wen, L., Li, Y., Zhang, X., Li, L., Wang, L., Zhang, T., Wang, G., Wang, Y. (2021) Noncanonical protease-activated receptor 1 regulates lymphatic differentiation in zebrafish. iScience. 24:103386
- Ackerman, S.D., Luo, R., Poitelon, Y., Mogha, A., Harty, B.L., D'Rozario, M., Sanchez, N.E., Lakkaraju, A.K.K., Gamble, P., Li, J., Qu, J., MacEwan, M.R., Ray, W.Z., Aguzzi, A., Feltri, M.L., Piao, X., Monk, K.R. (2018) GPR56/ADGRG1 regulates development and maintenance of peripheral myelin. The Journal of experimental medicine. 215(3):941-961
- Xie, H., Ye, D., Sepich, D., Lin, F. (2016) S1pr2/Gα13 signaling regulates the migration of endocardial precursors by controlling endoderm convergence. Developmental Biology. 414:228-43
- Ackerman, S.D., Garcia, C., Piao, X., Gutmann, D.H., Monk, K.R. (2015) The adhesion GPCR Gpr56 regulates oligodendrocyte development via interactions with Gα12/13 and RhoA. Nature communications. 6:6122
- Li, P., Lahvic, J.L., Binder, V., Pugach, E.K., Riley, E.B., Tamplin, O.J., Panigrahy, D., Bowman, T.V., Barrett, F.G., Heffner, G.C., McKinney-Freeman, S., Schlaeger, T.M., Daley, G.Q., Zeldin, D.C., Zon, L.I. (2015) Epoxyeicosatrienoic acids enhance embryonic haematopoiesis and adult marrow engraftment. Nature. 523:468-71
- Ye, D., Xie, H., Hu, B., Lin, F. (2015) Endoderm convergence controls subduction of the myocardial precursors during heart-tube formation. Development (Cambridge, England). 142:2928-40
- Fukui, H., Terai, K., Nakajima, H., Chiba, A., Fukuhara, S., Mochizuki, N. (2014) S1P-Yap1 Signaling Regulates Endoderm Formation Required for Cardiac Precursor Cell Migration in Zebrafish. Developmental Cell. 31:128-136
- Ye, D., and Lin, F. (2013) S1pr2/Gα13 signaling controls myocardial migration by regulating endoderm convergence. Development (Cambridge, England). 140(4):789-799
1 - 10 of 12
Show