Morpholino
MO3-tp53
- ID
- ZDB-MRPHLNO-060104-2
- Name
- MO3-tp53
- Previous Names
-
- p53-MO spl (1)
- Target
- Sequence
-
5' - AAAATGTCTGTACTATCTCCATCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tp53
No data available
Phenotype
Phenotype resulting from MO3-tp53
No data available
Phenotype of all Fish created by or utilizing MO3-tp53
1 - 5 of 11 Show all
Citations
- Lin, C.Y., Tsai, M.Y., Liu, Y.H., Lu, Y.F., Chen, Y.C., Lai, Y.R., Liao, H.C., Lien, H.W., Yang, C.H., Huang, C.J., Hwang, S.L. (2017) Klf8 regulates left-right asymmetric patterning through modulation of Kupffer's vesicle morphogenesis and spaw expression. Journal of Biomedical Science. 24:45
- Tsai, M., Lu, Y., Liu, Y., Lien, H., Huang, C., Wu, J., Hwang, S.L. (2015) Modulation of p53 and met expression by krüppel-like factor 8 regulates zebrafish cerebellar development. Developmental Neurobiology. 75(9):908-26
- Lien, H.W., Yang, C.H., Cheng, C.H., Hung, C.C., Liao, W.H., Hwang, P.P., Han, Y.S., and Huang, C.J. (2013) A Novel Zinc Finger Protein 219-like (ZNF219L) is Involved in the Regulation of Collagen Type 2 Alpha 1a (col2a1a) Gene Expression in Zebrafish Notochord. International journal of biological sciences. 9(9):872-886
- Provost, E., Wehner, K.A., Zhong, X., Ashar, F., Nguyen, E., Green, R., Parsons, M.J., and Leach, S.D. (2012) Ribosomal biogenesis genes play an essential and p53-independent role in zebrafish pancreas development. Development (Cambridge, England). 139(17):3232-3241
- Yang, C.H., Cheng, C.H., Chen, G.D., Liao, W.H., Chen, Y.C., Huang, K.Y., Hwang, P.P., Hwang, S.P., and Huang, C.J. (2011) Zona Pellucida Domain-Containing Protein β-Tectorin is Crucial for Zebrafish Proper Inner Ear Development. PLoS One. 6(8):e23078
- Davuluri, G., Gong, W., Yusuff, S., Lorent, K., Muthumani, M., Dolan, A.C., and Pack, M. (2008) Mutation of the zebrafish nucleoporin elys sensitizes tissue progenitors to replication stress. PLoS Genetics. 4(10):e1000240
- Skarie, J.M., and Link, B.A. (2008) The Primary open-angle glaucoma gene WDR36 functions in ribosomal RNA processing and interacts with the p53 stress–response pathway. Human molecular genetics. 17(16):2474-2485
- Chen, J., Ruan, H., Ng, S.M., Gao, C., Soo, H.M., Wu, W., Zhang, Z., Wen, Z., Lane, D.P., and Peng, J. (2005) Loss of function of def selectively up-regulates {Delta}113p53 expression to arrest expansion growth of digestive organs in zebrafish. Genes & Development. 19(23):2900-2911
1 - 8 of 8
Show