Morpholino
MO1-fgf19
- ID
- ZDB-MRPHLNO-051220-8
- Name
- MO1-fgf19
- Previous Names
-
- fgf19 MO (1)
- Target
- Sequence
-
5' - CAGTGACAAAGAGTAAGAGGAGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino targets the translation start site of fgf19.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf19
No data available
Phenotype
Phenotype resulting from MO1-fgf19
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-fgf19
1 - 5 of 9 Show all
Citations
- Miyake, A., Chitose, T., Kamei, E., Murakami, A., Nakayama, Y., Konishi, M., Itoh, N. (2014) Fgf16 Is Required for Specification of GABAergic Neurons and Oligodendrocytes in the Zebrafish Forebrain. PLoS One. 9:e110836
- Nakayama, Y., Miyake, A., Nakagawa, Y., Mido, T., Yoshikawa, M., Konishi, M., and Itoh, N. (2008) Fgf19 is required for zebrafish lens and retina development. Developmental Biology. 313(2):752-766
- Vinothkumar, S., Rastegar, S., Takamiya, M., Ertzer, R., and Strähle, U. (2008) Sequential and cooperative action of Fgfs and Shh in the zebrafish retina. Developmental Biology. 314(1):200-214
- Tamimi, Y., Skarie, J.M., Footz, T., Berry, F.B., Link, B.A., and Walter, M.A. (2006) FGF19 is a target for FOXC1 regulation in ciliary body derived cells. Human molecular genetics. 15(21):3229-3240
- Miyake, A., Nakayama, Y., Konishi, M., and Itoh, N. (2005) Fgf19 regulated by Hh signaling is required for zebrafish forebrain development. Developmental Biology. 288(1):259-275
1 - 5 of 5
Show