Morpholino
MO1-sox10
- ID
- ZDB-MRPHLNO-051220-4
- Name
- MO1-sox10
- Previous Names
-
- SMO1 (1)
- Target
- Sequence
-
5' - ATGCTGTGCTCCTCCGCCGACATCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sox10
No data available
Phenotype
Phenotype resulting from MO1-sox10
1 - 5 of 34 Show all
Phenotype of all Fish created by or utilizing MO1-sox10
1 - 5 of 62 Show all
Citations
- Takamiya, M., Stegmaier, J., Kobitski, A.Y., Schott, B., Weger, B.D., Margariti, D., Cereceda Delgado, A.R., Gourain, V., Scherr, T., Yang, L., Sorge, S., Otte, J.C., Hartmann, V., van Wezel, J., Stotzka, R., Reinhard, T., Schlunck, G., Dickmeis, T., Rastegar, S., Mikut, R., Nienhaus, G.U., Strähle, U. (2020) Pax6 organizes the anterior eye segment by guiding two distinct neural crest waves. PLoS Genetics. 16:e1008774
- Staudt, N., Giger, F.A., Fielding, T., Hutt, J.A., Foucher, I., Snowden, V., Hellich, A., Kiecker, C., Houart, C. (2019) Pineal progenitors originate from a non-neural territory limited by FGF signalling. Development (Cambridge, England). 146(22):
- Kamei, H., Yoneyama, Y., Hakuno, F., Sawada, R., Shimizu, T., Duan, C., Takahashi, S.I. (2018) Catch-up growth in zebrafish embryo requires neural crest cells sustained by Irs1-signaling. Endocrinology. 159(4):1547-1560
- Damm, E.W., Clements, W.K. (2017) Pdgf signalling guides neural crest contribution to the haematopoietic stem cell specification niche. Nature cell biology. 19(5):457-467
- Asad, Z., Pandey, A., Babu, A., Sun, Y., Shevade, K., Kapoor, S., Ullah, I., Ranjan, S., Scaria, V., Bajpai, R., Sachidanandan, C. (2016) Rescue of neural crest derived phenotypes in a zebrafish CHARGE model by sox10 downregulation. Human molecular genetics. 25(16):3539-3554
- Tang, C.H., Lai, Y.R., Chen, Y.C., Li, C.H., Lu, Y.F., Chen, H.Y., Lien, H.W., Yang, C.H., Huang, C.J., Wang, C.Y., Kao, C.F., Hwang, S.P. (2014) Expression of zebrafish anterior gradient 2 in the semicircular canals and supporting cells of otic vesicle sensory patches is regulated by Sox10. Biochimica et biophysica acta. Gene regulatory mechanisms. 1839(6):425-37
- Saxena, A., Peng, B.N., and Bronner, M.E. (2013) Sox10-dependent neural crest origin of olfactory microvillous neurons in zebrafish. eLIFE. 2:e00336
- Drerup, C.M., Wiora, H.M., Topczewski, J., and Morris, J.A. (2009) Disc1 regulates foxd3 and sox10 expression, affecting neural crest migration and differentiation. Development (Cambridge, England). 136(15):2623-2632
- Whitlock, K.E., Smith, K.M., Kim, H., and Harden, M.V. (2005) A role for foxd3 and sox10 in the differentiation of gonadotropin-releasing hormone (GnRH) cells in the zebrafish Danio rerio. Development (Cambridge, England). 132(24):5491-5502
1 - 9 of 9
Show