Morpholino

MO2-wnt5b

ID

ZDB-MRPHLNO-051207-1

Name

MO2-wnt5b

Previous Names

None

Target

wnt5b (1)

Sequence

5' - TGTTTATTTCCTCACCATTCTTCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the 3' end of the exon-intron junction of exon 3. Robu et al. report that it is the splice-site–exon 6 splice acceptor (exon 5–6 junction)that is targeted.

Genome Resources

MODB:505 (2)

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-wnt5b

Expressed Gene	Anatomy	Figures
cdkn1a	whole organism	Fig. 8 from Robu et al., 2007
cp	liver	Fig. 6 from Kim et al., 2005
cpa5	exocrine pancreas	Fig. 6 from Kim et al., 2005
foxa3	endoderm	Fig. 4 from Kim et al., 2005
gata6	endoderm	Fig. 4 from Kim et al., 2005
gcga	posterior pancreatic bud	Fig. 5 from Kim et al., 2005
ins	endocrine pancreas pancreas primordium	Fig. 3 , Fig. 6 from Kim et al., 2005
isl1a	posterior pancreatic bud	Fig. 5 from Kim et al., 2005
mixl1	presumptive endoderm	Fig. 4 from Kim et al., 2005
pdx1	pancreas pancreas primordium	Fig. 6 from Kim et al., 2005
sox17	endoderm	Fig. 4 from Kim et al., 2005
spon1b	posterior pancreatic bud	Fig. 5 from Kim et al., 2005
sst2	posterior pancreatic bud	Fig. 5 from Kim et al., 2005
tp53	head whole organism	Fig. 9 from Robu et al., 2007
wnt5b	(not) whole organism	Fig. 1 from Robu et al., 2007

Phenotype

Phenotype resulting from MO2-wnt5b

Phenotype	Fish	Figures
cell migration disrupted, abnormal	WT + MO2-wnt5b	Fig. 3 , Fig. 5 from Kim et al., 2005
convergent extension involved in axis elongation disrupted, abnormal	WT + MO2-wnt5b	Fig. 3 from Kim et al., 2005
endocrine pancreas development disrupted, abnormal	WT + MO2-wnt5b	Fig. 3 , Fig. 5 , Fig. 6 from Kim et al., 2005
extension decreased length, abnormal	WT + MO2-wnt5b	Fig. 3 from Kim et al., 2005
head decreased size, abnormal	WT + MO2-wnt5b	Fig. 1 , Fig. 3 , Fig. 4 from Robu et al., 2007
hindbrain decreased size, abnormal	WT + MO2-wnt5b	Fig. 4 from Robu et al., 2007
midbrain hindbrain boundary constriction basal region increased width, abnormal	AB + MO2-wnt5b + MO4-tp53	Fig. 2 from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region structure, abnormal	AB + MO2-wnt5b + MO4-tp53	Fig. 2 from Gutzman et al., 2018
midbrain hindbrain boundary constriction epithelial cell morphogenesis process quality, abnormal	AB + MO2-wnt5b + MO4-tp53	Fig. 2 from Gutzman et al., 2018
midbrain hindbrain boundary constriction midbrain-hindbrain boundary morphogenesis process quality, abnormal	AB + MO2-wnt5b + MO4-tp53	Fig. 2 from Gutzman et al., 2018
nervous system apoptotic, abnormal	WT + MO2-wnt5b	Fig. 1 , Fig. 2 , Fig. 3 , Fig. 4 from Robu et al., 2007
pancreas development disrupted, abnormal	WT + MO2-wnt5b	Fig. 6 from Kim et al., 2005
post-vent region decreased length, abnormal	WT + MO2-wnt5b	Fig. 1 from Robu et al., 2007 Fig. 3 from Kim et al., 2005
somite condensed, abnormal	WT + MO2-wnt5b	Fig. 1 from Robu et al., 2007
somite morphology, abnormal	WT + MO2-wnt5b	Fig. 3 from Kim et al., 2005
tail bud morphology, abnormal	WT + MO2-wnt5b	Fig. 3 from Kim et al., 2005
whole organism decreased length, abnormal	WT + MO2-wnt5b	Fig. 1 from Robu et al., 2007 Fig. 3 from Kim et al., 2005

Phenotype of all Fish created by or utilizing MO2-wnt5b

Phenotype	Fish	Conditions	Figures
midbrain hindbrain boundary constriction basal region increased width, abnormal	AB + MO2-wnt5b + MO4-tp53	control	Fig. 2 from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region structure, abnormal	AB + MO2-wnt5b + MO4-tp53	control	Fig. 2 from Gutzman et al., 2018
midbrain hindbrain boundary constriction midbrain-hindbrain boundary morphogenesis process quality, abnormal	AB + MO2-wnt5b + MO4-tp53	control	Fig. 2 from Gutzman et al., 2018
midbrain hindbrain boundary constriction epithelial cell morphogenesis process quality, abnormal	AB + MO2-wnt5b + MO4-tp53	control	Fig. 2 from Gutzman et al., 2018
cell migration disrupted, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 3 , Fig. 5 from Kim et al., 2005
extension decreased length, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 3 from Kim et al., 2005
convergent extension involved in axis elongation disrupted, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 3 from Kim et al., 2005
pancreas development disrupted, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 6 from Kim et al., 2005
somite morphology, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 3 from Kim et al., 2005
hindbrain decreased size, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 4 from Robu et al., 2007
nervous system apoptotic, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 1 , Fig. 2 , Fig. 3 , Fig. 4 from Robu et al., 2007
head decreased size, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 1 , Fig. 3 , Fig. 4 from Robu et al., 2007
endocrine pancreas development disrupted, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 3 , Fig. 5 , Fig. 6 from Kim et al., 2005
post-vent region decreased length, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 1 from Robu et al., 2007 Fig. 3 from Kim et al., 2005
whole organism decreased length, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 1 from Robu et al., 2007 Fig. 3 from Kim et al., 2005
tail bud morphology, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 3 from Kim et al., 2005
somite condensed, abnormal	WT + MO2-wnt5b	standard conditions	Fig. 1 from Robu et al., 2007
whole organism decreased length, abnormal	WT + MO2-wnt5b + MO4-tp53	standard conditions	Fig. 1 from Robu et al., 2007
post-vent region decreased length, abnormal	WT + MO2-wnt5b + MO4-tp53	standard conditions	Fig. 1 from Robu et al., 2007
somite condensed, abnormal	WT + MO2-wnt5b + MO4-tp53	standard conditions	Fig. 1 from Robu et al., 2007
cardiac muscle tissue morphogenesis process quality, abnormal	WT + MO2-wnt11f2 + MO2-wnt5b	control	Fig. 2 from Merks et al., 2018

Citations