Morpholino

MO2-wnt5b

ID
ZDB-MRPHLNO-051207-1
Name
MO2-wnt5b
Previous Names
None
Target
Sequence
5' - TGTTTATTTCCTCACCATTCTTCCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 3' end of the exon-intron junction of exon 3. Robu et al. report that it is the splice-site–exon 6 splice acceptor (exon 5–6 junction)that is targeted.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt5b
No data available
Phenotype
Phenotype resulting from MO2-wnt5b
Phenotype Fish Figures
cell migration disrupted, abnormal WT + MO2-wnt5b Fig. 3 with imageFig. 5 with image from Kim et al., 2005
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-wnt5b Fig. 3 with image from Kim et al., 2005
endocrine pancreas development disrupted, abnormal WT + MO2-wnt5b Fig. 3 with imageFig. 5 with imageFig. 6 with image from Kim et al., 2005
extension decreased length, abnormal WT + MO2-wnt5b Fig. 3 with image from Kim et al., 2005
head decreased size, abnormal WT + MO2-wnt5b Fig. 1 with imageFig. 3 with imageFig. 4 with image from Robu et al., 2007
hindbrain decreased size, abnormal WT + MO2-wnt5b Fig. 4 with image from Robu et al., 2007
midbrain hindbrain boundary constriction basal region increased width, abnormal AB + MO2-wnt5b + MO4-tp53 Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region structure, abnormal AB + MO2-wnt5b + MO4-tp53 Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction epithelial cell morphogenesis process quality, abnormal AB + MO2-wnt5b + MO4-tp53 Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction midbrain-hindbrain boundary morphogenesis process quality, abnormal AB + MO2-wnt5b + MO4-tp53 Fig. 2 with image from Gutzman et al., 2018
nervous system apoptotic, abnormal WT + MO2-wnt5b Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with image from Robu et al., 2007
pancreas development disrupted, abnormal WT + MO2-wnt5b Fig. 6 with image from Kim et al., 2005
post-vent region decreased length, abnormal WT + MO2-wnt5b + MO4-tp53 Fig. 1 with image from Robu et al., 2007
Fig. 3 with image from Kim et al., 2005
somite condensed, abnormal WT + MO2-wnt5b + MO4-tp53 Fig. 1 with image from Robu et al., 2007
somite morphology, abnormal WT + MO2-wnt5b Fig. 3 with image from Kim et al., 2005
tail bud morphology, abnormal WT + MO2-wnt5b Fig. 3 with image from Kim et al., 2005
whole organism decreased length, abnormal WT + MO2-wnt5b Fig. 1 with image from Robu et al., 2007
Fig. 3 with image from Kim et al., 2005
Phenotype of all Fish created by or utilizing MO2-wnt5b
Phenotype Fish Conditions Figures
midbrain hindbrain boundary constriction basal region increased width, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region structure, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction midbrain-hindbrain boundary morphogenesis process quality, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction epithelial cell morphogenesis process quality, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
cell migration disrupted, abnormal WT + MO2-wnt5b standard conditions Fig. 3 with imageFig. 5 with image from Kim et al., 2005
extension decreased length, abnormal WT + MO2-wnt5b standard conditions Fig. 3 with image from Kim et al., 2005
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-wnt5b standard conditions Fig. 3 with image from Kim et al., 2005
pancreas development disrupted, abnormal WT + MO2-wnt5b standard conditions Fig. 6 with image from Kim et al., 2005
somite morphology, abnormal WT + MO2-wnt5b standard conditions Fig. 3 with image from Kim et al., 2005
hindbrain decreased size, abnormal WT + MO2-wnt5b standard conditions Fig. 4 with image from Robu et al., 2007
nervous system apoptotic, abnormal WT + MO2-wnt5b standard conditions Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with image from Robu et al., 2007
head decreased size, abnormal WT + MO2-wnt5b standard conditions Fig. 1 with imageFig. 3 with imageFig. 4 with image from Robu et al., 2007
endocrine pancreas development disrupted, abnormal WT + MO2-wnt5b standard conditions Fig. 3 with imageFig. 5 with imageFig. 6 with image from Kim et al., 2005
post-vent region decreased length, abnormal WT + MO2-wnt5b standard conditions Fig. 1 with image from Robu et al., 2007
Fig. 3 with image from Kim et al., 2005
whole organism decreased length, abnormal WT + MO2-wnt5b standard conditions Fig. 1 with image from Robu et al., 2007
Fig. 3 with image from Kim et al., 2005
tail bud morphology, abnormal WT + MO2-wnt5b standard conditions Fig. 3 with image from Kim et al., 2005
somite condensed, abnormal WT + MO2-wnt5b standard conditions Fig. 1 with image from Robu et al., 2007
whole organism decreased length, abnormal WT + MO2-wnt5b + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
post-vent region decreased length, abnormal WT + MO2-wnt5b + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
somite condensed, abnormal WT + MO2-wnt5b + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
cardiac muscle tissue morphogenesis process quality, abnormal WT + MO2-wnt11f2 + MO2-wnt5b control Fig. 2 from Merks et al., 2018
Citations