Morpholino
MO1-fgf10a
- ID
- ZDB-MRPHLNO-051130-1
- Name
- MO1-fgf10a
- Previous Names
-
- e2i2 fgf10 MO (1)
- MO1-fgf10
- Target
- Sequence
-
5' - GAAAATGATGCTCACCGCCCCGTAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
targeted to the exon2-intron2 splice junction
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf10a
No data available
Phenotype
Phenotype resulting from MO1-fgf10a
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-fgf10a
1 - 4 of 4
Citations
- Durdu, S., Iskar, M., Revenu, C., Schieber, N., Kunze, A., Bork, P., Schwab, Y., Gilmour, D. (2014) Luminal signalling links cell communication to tissue architecture during organogenesis. Nature. 515(7525):120-4
- Matsuda, M., Nogare, D.D., Somers, K., Martin, K., Wang, C., and Chitnis, A.B. (2013) Lef1 regulates Dusp6 to influence neuromast formation and spacing in the zebrafish posterior lateral line primordium. Development (Cambridge, England). 140(11):2387-2397
- Manfroid, I., Delporte, F., Baudhuin, A., Motte, P., Neumann, C.J., Voz, M.L., Martial, J.A., and Peers, B. (2007) Reciprocal endoderm-mesoderm interactions mediated by fgf24 and fgf10 govern pancreas development. Development (Cambridge, England). 134(22):4011-4021
- Norton, W.H., Ledin, J., Grandel, H., and Neumann, C.J. (2005) HSPG synthesis by zebrafish Ext2 and Extl3 is required for Fgf10 signalling during limb development. Development (Cambridge, England). 132(22):4963-4973
1 - 4 of 4
Show