Morpholino
MO3-runx1
- ID
- ZDB-MRPHLNO-051102-4
- Name
- MO3-runx1
- Previous Names
-
- runxMO5 (1)
- Target
- Sequence
-
5' - AATGTGTAAACTCACAGTGTAAAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-runx1
No data available
Phenotype
Phenotype resulting from MO3-runx1
No data available
Phenotype of all Fish created by or utilizing MO3-runx1
1 - 5 of 5
Citations
- Wang, T., Yan, B., Lou, L., Lin, X., Yu, T., Wu, S., Lu, Q., Liu, W., Huang, Z., Zhang, M., Zhang, W., Wen, Z. (2019) Nlrc3-like is required for microglia maintenance in zebrafish. Journal of genetics and genomics = Yi chuan xue bao. 46(6):291-299
- Zhen, F., Lan, Y., Yan, B., Zhang, W., and Wen, Z. (2013) Hemogenic endothelium specification and hematopoietic stem cell maintenance employ distinct Scl isoforms. Development (Cambridge, England). 140(19):3977-3985
- Da'as, S.I., Coombs, A.J., Balci, T.B., Grondin, C.A., Ferrando, A.A., and Berman, J.N. (2012) The zebrafish reveals dependence of the mast cell lineage on Notch signaling in vivo. Blood. 119(15):3585-3594
- Jin, H., Sood, R., Xu, J., Zhen, F., English, M.A., Liu, P.P., and Wen, Z. (2009) Definitive hematopoietic stem/progenitor cells manifest distinct differentiation output in the zebrafish VDA and PBI. Development (Cambridge, England). 136(4):647-654
- Burns, C.E., Traver, D., Mayhall, E., Shepard, J.L., and Zon, L.I. (2005) Hematopoietic stem cell fate is established by the Notch-Runx pathway. Genes & Development. 19(19):2331-2342
1 - 5 of 5
Show