Morpholino
MO1-cxcl12b
- ID
- ZDB-MRPHLNO-051028-1
- Name
- MO1-cxcl12b
- Previous Names
-
- cxcl12b MORPH 1736 (1)
- Target
- Sequence
-
5' - CGCTACTACTTTGCTATCCATGCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cxcl12b
No data available
Phenotype
Phenotype resulting from MO1-cxcl12b
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-cxcl12b
1 - 5 of 36 Show all
Citations
- Wei, Z., Hong, Q., Ding, Z., Liu, J. (2023) cxcl12a plays an essential role in pharyngeal cartilage development. Frontiers in cell and developmental biology. 11:12432651243265
- Jiang, D., Jiang, Z., Lu, D., Wang, X., Liang, H., Zhang, J., Meng, Y., Li, Y., Wu, D., Huang, Y., Chen, Y., Deng, H., Wu, Q., Xiong, J., Meng, A., Yu, L. (2019) Migrasomes provide regional cues for organ morphogenesis during zebrafish gastrulation. Nature cell biology. 21:966-977
- Nguyen, P.D., Hollway, G.E., Sonntag, C., Miles, L.B., Hall, T.E., Berger, S., Fernandez, K.J., Gurevich, D.B., Cole, N.J., Alaei, S., Ramialison, M., Sutherland, R.L., Polo, J.M., Lieschke, G.J., Currie, P.D. (2014) Haematopoietic stem cell induction by somite-derived endothelial cells controlled by meox1. Nature. 512(7514):314-8
- Lewellis, S.W., Nagelberg, D., Subedi, A., Staton, A., Leblanc, M., Giraldez, A., and Knaut, H. (2013) Precise SDF1-mediated cell guidance is achieved through ligand clearance and microRNA-mediated decay. The Journal of cell biology. 200(3):337-355
- Cha, Y.R., Fujita, M., Butler, M., Isogai, S., Kochhan, E., Siekmann, A.F., and Weinstein, B.M. (2012) Chemokine Signaling Directs Trunk Lymphatic Network Formation along the Preexisting Blood Vasculature. Developmental Cell. 22(4):824-836
- Boldajipour, B., Doitsidou, M., Tarbashevich, K., Laguri, C., Yu, S.R., Ries, J., Dumstrei, K., Thelen, S., Dörries, J., Messerschmidt, E.M., Thelen, M., Schwille, P., Brand, M., Lortat-Jacob, H., and Raz, E. (2011) Cxcl12 evolution - subfunctionalization of a ligand through altered interaction with the chemokine receptor. Development (Cambridge, England). 138(14):2909-2914
- Fujita, M., Cha, Y.R., Pham, V.N., Sakurai, A., Roman, B.L., Gutkind, J.S., and Weinstein, B.M. (2011) Assembly and patterning of the vascular network of the vertebrate hindbrain. Development (Cambridge, England). 138(9):1705-1715
- Palevitch, O., Abraham, E., Borodovsky, N., Levkowitz, G., Zohar, Y., and Gothilf, Y. (2010) Cxcl12a-Cxcr4b signaling is important for proper development of the forebrain GnRH system in zebrafish. General and comparative endocrinology. 165(2):262-268
- Walters, K.B., Green, J.M., Surfus, J.C., Yoo, S.K., and Huttenlocher, A. (2010) Live imaging of neutrophil motility in a zebrafish model of WHIM syndrome. Blood. 116(15):2803-2811
- Olesnicky Killian, E.C., Birkholz, D.A., and Artinger, K.B. (2009) A role for chemokine signaling in neural crest cell migration and craniofacial development. Developmental Biology. 333(1):161-172
1 - 10 of 18
Show