Morpholino
MO2-cdkn1ca
- ID
- ZDB-MRPHLNO-050908-1
- Name
- MO2-cdkn1ca
- Previous Names
- Target
- Sequence
-
5' - CCACGTTTGCCATGATGTCTAAAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cdkn1ca
No data available
Phenotype
Phenotype resulting from MO2-cdkn1ca
| Phenotype | Fish | Figures |
|---|---|---|
| adaxial cell decreased amount, abnormal | WT + MO2-cdkn1ca |
Fig. 3 
from Osborn et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-cdkn1ca
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| adaxial cell decreased amount, abnormal | WT + MO2-cdkn1ca | standard conditions |
Fig. 3
from Osborn et al., 2011 |
1 - 1 of 1
Citations
- Osborn, D.P., Li, K., Hinits, Y., and Hughes, S.M. (2011) Cdkn1c drives muscle differentiation through a positive feedback loop with Myod. Developmental Biology. 350(2):464-475
- Fischer, S., Prykhozhij, S., Rau, M.J., and Neumann, C.J. (2007) Mutation of Zebrafish caf-1b Results in S Phase Arrest, Defective Differentiation, and p53-Mediated Apoptosis During Organogenesis. Cell cycle (Georgetown, Tex.). 6(23):2962-2969
- Shkumatava, A., and Neumann, C.J. (2005) Shh directs cell-cycle exit by activating p57Kip2 in the zebrafish retina. EMBO reports. 6(6):563-569
1 - 3 of 3
Show