Morpholino
MO1-flt1
- ID
- ZDB-MRPHLNO-050906-4
- Name
- MO1-flt1
- Previous Names
-
- mflt1-splice MO (1)
- Target
- Sequence
-
5' - CAGCAGTTCACTCACATCTCCGTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocker.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-flt1
No data available
Phenotype
Phenotype resulting from MO1-flt1
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-flt1
1 - 5 of 7 Show all
Citations
- Hen, G., Nicenboim, J., Mayseless, O., Asaf, L., Shin, M., Busolin, G., Hofi, R., Almog, G., Tiso, N., Lawson, N.D., Yaniv, K. (2015) Venous-derived angioblasts generate organ-specific vessels during embryonic development. Development (Cambridge, England). 142(24):4266-78
- Ba, Q., Duan, J., Tian, J.Q., Wang, Z.L., Chen, T., Li, X.G., Chen, P.Z., Wu, S.J., Xiang, L., Li, J.Q., Chu, R.A., and Wang, H. (2013) Dihydroartemisinin promotes angiogenesis during the early embryonic development of zebrafish. Acta Pharmacologica Sinica. 34(8):1101-7
- Hassel, D., Cheng, P., White, M.P., Ivey, K.N., Kroll, J., Augustin, H.G., Katus, H.A., Stainier, D.Y., and Srivastava, D. (2012) MicroRNA-10 Regulates the Angiogenic Behavior of Zebrafish and Human Endothelial Cells by Promoting Vascular Endothelial Growth Factor Signaling. Circulation research. 111(11):1421-1433
- Zygmunt, T., Gay, C.M., Blondelle, J., Singh, M.K., Flaherty, K.M., Means, P.C., Herwig, L., Krudewig, A., Belting, H.G., Affolter, M., Epstein, J.A., and Torres-Vazquez, J. (2011) Semaphorin-PlexinD1 Signaling Limits Angiogenic Potential via the VEGF Decoy Receptor sFlt1. Developmental Cell. 21(2):301-314
- Rottbauer, W., Just, S., Wessels, G., Trano, N., Most, P., Katus, H.A., and Fishman, M.C. (2005) VEGF-PLC{gamma}1 pathway controls cardiac contractility in the embryonic heart. Genes & Development. 19(13):1624-1634
1 - 5 of 5
Show