Morpholino

MO1-ctbp2a

ID

ZDB-MRPHLNO-050902-4

Name

MO1-ctbp2a

Previous Names

MO1-ctbp2

Target

ctbp2a (1)

Sequence

5' - CTGGAGATCAACATGAGGAAAAGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ctbp2a

Expressed Gene	Anatomy	Figures
alcama	retinal ganglion cell	Fig. 7 from Wan et al., 2005
ctbp2a	(not) neuromast hair cell	Fig. 2 , Fig. 3 from Sheets et al., 2011
ctbp2l	neuromast hair cell	Fig. 2 , Fig. 3 from Sheets et al., 2011
vsx1	bipolar neuron retina	Fig. 6 from Wan et al., 2005

Phenotype

Phenotype resulting from MO1-ctbp2a

Phenotype	Fish	Figures
apoptotic process increased occurrence, abnormal	WT + MO1-ctbp2a	Fig. 8 from Wan et al., 2005
eye movement quality, abnormal	WT + MO1-ctbp2a	Fig. 3 from Wan et al., 2005
eye photoreceptor cell cytoskeleton of presynaptic active zone decreased length, abnormal	WT + MO1-ctbp2a	Fig. 5 from Wan et al., 2005
optokinetic behavior disrupted, abnormal	WT + MO1-ctbp2a	Fig. 3 from Wan et al., 2005
response to auditory stimulus decreased process quality, abnormal	WT + MO1-ctbp2a	Fig. 4 from Sheets et al., 2011
retina apoptotic, abnormal	WT + MO1-ctbp2a	Fig. 8 from Wan et al., 2005
retinal bipolar neuron cytoskeleton of presynaptic active zone morphology, abnormal	WT + MO1-ctbp2a	Fig. 5 from Wan et al., 2005
rod bipolar cell decreased amount, abnormal	WT + MO1-ctbp2a	Fig. 7 from Wan et al., 2005

Phenotype of all Fish created by or utilizing MO1-ctbp2a

Phenotype	Fish	Conditions	Figures
retinal bipolar neuron cytoskeleton of presynaptic active zone morphology, abnormal	WT + MO1-ctbp2a	standard conditions	Fig. 5 from Wan et al., 2005
eye movement quality, abnormal	WT + MO1-ctbp2a	standard conditions	Fig. 3 from Wan et al., 2005
retina apoptotic, abnormal	WT + MO1-ctbp2a	standard conditions	Fig. 8 from Wan et al., 2005
optokinetic behavior disrupted, abnormal	WT + MO1-ctbp2a	standard conditions	Fig. 3 from Wan et al., 2005
apoptotic process increased occurrence, abnormal	WT + MO1-ctbp2a	standard conditions	Fig. 8 from Wan et al., 2005
response to auditory stimulus decreased process quality, abnormal	WT + MO1-ctbp2a	standard conditions	Fig. 4 from Sheets et al., 2011
rod bipolar cell decreased amount, abnormal	WT + MO1-ctbp2a	standard conditions	Fig. 7 from Wan et al., 2005
eye photoreceptor cell cytoskeleton of presynaptic active zone decreased length, abnormal	WT + MO1-ctbp2a	standard conditions	Fig. 5 from Wan et al., 2005
posterior lateral line nerve postsynaptic density separated from neuromast hair cell cytoskeleton of presynaptic active zone, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 7 from Sheets et al., 2011
presynaptic membrane assembly decreased process quality, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 8 from Sheets et al., 2011
neuromast hair cell voltage-gated calcium channel complex decreased distribution, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 8 from Sheets et al., 2011
response to auditory stimulus decreased process quality, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 4 from Sheets et al., 2011
postsynaptic density assembly decreased process quality, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 7 from Sheets et al., 2011
clustering of voltage-gated calcium channels decreased process quality, abnormal	WT + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 8 from Sheets et al., 2011
axonogenesis involved in innervation decreased process quality, abnormal	nl1Tg + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 6 from Sheets et al., 2011
neuromast hair cell cytoskeleton of presynaptic active zone decreased amount, abnormal	nl1Tg + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 6 from Sheets et al., 2011
posterior lateral line nerve dendrite decreased length, abnormal	nl1Tg + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 6 from Sheets et al., 2011
posterior lateral line nerve dendrite unbranched, abnormal	nl1Tg + MO1-ctbp2a + MO2-ctbp2l	standard conditions	Fig. 6 from Sheets et al., 2011

Citations